Mutagenetix > Incidental Mutations

Incidental Mutation 'R5879:Arhgap39'

455731

Institutional Source

Beutler Lab

Gene Symbol

Arhgap39

Ensembl Gene

ENSMUSG00000033697

Gene Name

Rho GTPase activating protein 39

Synonyms

D15Wsu169e

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.262) question?

Stock #

R5879 (G1)

Quality Score

216

Status

Not validated

Chromosome

Chromosomal Location

76723985-76818170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76751807 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 76 (D76G)

Ref Sequence

ENSEMBL: ENSMUSP00000135043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821] [ENSMUST00000176855]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036176
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: D76G

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	759	904	2.3e-32	PFAM
RhoGAP	932	1105	5.9e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000077821
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: D76G

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	756	874	3.3e-25	PFAM
RhoGAP	901	1074	5.9e-28	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176855
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135043
Gene: ENSMUSG00000033697
AA Change: D76G

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177011

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110062M04Rik	A	G	6: 34,874,658	L87P	probably damaging	Het
Aldh16a1	C	T	7: 45,147,506	W66*	probably null	Het
Arhgef2	G	A	3: 88,643,617		probably null	Het
C1qtnf2	T	C	11: 43,486,008	M99T	probably damaging	Het
Eml3	G	A	19: 8,935,015	C392Y	possibly damaging	Het
Ephb4	C	A	5: 137,360,416	P287Q	probably benign	Het
Fat4	G	T	3: 38,887,336	R126L	probably benign	Het
Flt3	T	C	5: 147,334,909	M858V	probably damaging	Het
Gm13083	A	T	4: 143,617,591	Y487F	possibly damaging	Het
Gprin3	A	C	6: 59,354,713	I203R	probably benign	Het
Insr	G	T	8: 3,198,173	Y457*	probably null	Het
Ipo13	G	A	4: 117,903,203	T649I	possibly damaging	Het
Krba1	A	G	6: 48,415,744	D818G	possibly damaging	Het
Llgl1	G	A	11: 60,712,980	G1016R	probably benign	Het
Loxl4	A	G	19: 42,607,627	V142A	probably benign	Het
Mthfd1	A	G	12: 76,294,218	I464V	probably benign	Het
Mycs	C	A	X: 5,468,077	K316N	probably damaging	Het
Ncor2	A	G	5: 125,026,775		probably benign	Het
Nlrc3	A	G	16: 3,964,045	F516S	probably damaging	Het
Oacyl	A	G	18: 65,749,672	S540G	probably damaging	Het
Olfml2a	A	T	2: 38,960,230	T653S	probably damaging	Het
Olfr285	C	T	15: 98,313,488	V21I	probably benign	Het
Pcnx2	A	T	8: 125,773,946	N1468K	probably damaging	Het
Plbd1	A	G	6: 136,634,505	I258T	probably damaging	Het
Ppargc1b	C	G	18: 61,309,093	D591H	probably damaging	Het
Prop1	C	T	11: 50,953,326	V27M	probably damaging	Het
Rfx4	T	G	10: 84,814,761		probably null	Het
Rgs11	C	T	17: 26,203,463		probably benign	Het
Slc6a5	T	A	7: 49,945,512	F541I	probably damaging	Het
Srgap3	A	T	6: 112,722,846	V1057E	possibly damaging	Het
Synpo2	A	T	3: 123,114,297	W457R	probably damaging	Het
Tet2	T	A	3: 133,487,960	N238Y	possibly damaging	Het
Tiam2	T	A	17: 3,437,265	M687K	probably damaging	Het
Ticrr	A	G	7: 79,696,690	E1866G	probably benign	Het
Tspan8	T	C	10: 115,833,251	S64P	possibly damaging	Het
Ugt2b37	C	T	5: 87,254,406	G122D	probably benign	Het
Uqcrc2	A	G	7: 120,637,888	E53G	probably damaging	Het
Vcan	T	C	13: 89,703,952	D963G	probably damaging	Het
Vmn2r24	T	A	6: 123,787,267	Y368N	possibly damaging	Het
Wdr5	A	G	2: 27,528,311	T208A	probably benign	Het
Zbtb18	A	G	1: 177,448,370	Y423C	probably damaging	Het
Zc3h6	A	G	2: 128,997,776		probably null	Het

Other mutations in Arhgap39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Arhgap39	APN	15	76737815	splice site	probably benign
IGL01586:Arhgap39	APN	15	76730438	missense	probably benign	0.16
IGL01693:Arhgap39	APN	15	76725967	missense	probably null	1.00
IGL02017:Arhgap39	APN	15	76737037	missense	probably damaging	0.98
IGL02508:Arhgap39	APN	15	76724984	makesense	probably null
IGL03333:Arhgap39	APN	15	76726732	missense	probably benign	0.05
R0328:Arhgap39	UTSW	15	76751952	splice site	probably benign
R0432:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0479:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0549:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0551:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R1054:Arhgap39	UTSW	15	76751559	missense	probably benign
R1830:Arhgap39	UTSW	15	76735183	missense	probably damaging	1.00
R2421:Arhgap39	UTSW	15	76725146	missense	probably damaging	1.00
R2497:Arhgap39	UTSW	15	76725385	missense	probably damaging	1.00
R3909:Arhgap39	UTSW	15	76751888	missense	probably benign	0.03
R4410:Arhgap39	UTSW	15	76725512	unclassified	probably benign
R4626:Arhgap39	UTSW	15	76737637	missense	possibly damaging	0.92
R4790:Arhgap39	UTSW	15	76726731	missense	possibly damaging	0.51
R4792:Arhgap39	UTSW	15	76741517	missense	possibly damaging	0.92
R4911:Arhgap39	UTSW	15	76737805	missense	probably damaging	1.00
R5225:Arhgap39	UTSW	15	76725515	unclassified	probably benign
R5417:Arhgap39	UTSW	15	76735101	missense	possibly damaging	0.80
R5443:Arhgap39	UTSW	15	76797925	intron	probably benign
R5521:Arhgap39	UTSW	15	76765494	missense	possibly damaging	0.66
R5686:Arhgap39	UTSW	15	76726633	missense	probably damaging	1.00
R5747:Arhgap39	UTSW	15	76741535	missense	possibly damaging	0.68
R5785:Arhgap39	UTSW	15	76737418	missense	probably benign
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6049:Arhgap39	UTSW	15	76727401	critical splice donor site	probably null
R6143:Arhgap39	UTSW	15	76730406	nonsense	probably null
R6232:Arhgap39	UTSW	15	76736512	missense	probably damaging	1.00
R6276:Arhgap39	UTSW	15	76737536	missense	probably benign	0.06
R6277:Arhgap39	UTSW	15	76735137	missense	probably damaging	1.00
R6305:Arhgap39	UTSW	15	76737702	missense	probably benign	0.31
R6587:Arhgap39	UTSW	15	76737499	missense	probably damaging	1.00
R7153:Arhgap39	UTSW	15	76765491	missense	probably benign	0.09
R7447:Arhgap39	UTSW	15	76765597	start gained	probably benign
R7658:Arhgap39	UTSW	15	76737417	missense	probably benign	0.03
R8071:Arhgap39	UTSW	15	76737502	missense	probably benign
R8269:Arhgap39	UTSW	15	76751742	missense	probably benign	0.35
R8368:Arhgap39	UTSW	15	76735255	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTGACCAAGGTTGTTGCC -3'
(R):5'- GGAAGCCCCTGTACAGTAAG -3'

Sequencing Primer
(F):5'- AACTGGCAGCTCCTGTGTC -3'
(R):5'- CCCCTGTACAGTAAGGGGAG -3'

Posted On

2017-02-10