Incidental Mutation 'R5879:Olfr285'
ID455733
Institutional Source Beutler Lab
Gene Symbol Olfr285
Ensembl Gene ENSMUSG00000062037
Gene Nameolfactory receptor 285
SynonymsMOR160-3, GA_x6K02T2NBG7-5440777-5441736
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98309203-98317353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98313488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 21 (V21I)
Ref Sequence ENSEMBL: ENSMUSP00000150788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079736] [ENSMUST00000216901]
Predicted Effect probably benign
Transcript: ENSMUST00000079736
AA Change: V21I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078672
Gene: ENSMUSG00000062037
AA Change: V21I

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 9.3e-47 PFAM
Pfam:7tm_1 39 286 5.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216901
AA Change: V21I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Olfr285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01986:Olfr285 APN 15 98312779 missense probably damaging 0.99
IGL02658:Olfr285 APN 15 98313356 missense probably damaging 1.00
R1423:Olfr285 UTSW 15 98313443 missense probably damaging 0.99
R1442:Olfr285 UTSW 15 98313187 missense probably damaging 0.98
R1863:Olfr285 UTSW 15 98313491 missense probably benign 0.02
R1938:Olfr285 UTSW 15 98313380 missense probably damaging 1.00
R4815:Olfr285 UTSW 15 98312680 missense probably damaging 1.00
R5248:Olfr285 UTSW 15 98313430 missense probably damaging 1.00
R6000:Olfr285 UTSW 15 98313436 missense probably benign 0.08
R6371:Olfr285 UTSW 15 98313338 missense possibly damaging 0.46
R7466:Olfr285 UTSW 15 98313380 missense probably damaging 1.00
R7708:Olfr285 UTSW 15 98313148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGATTCTCCAGCATCTTGG -3'
(R):5'- TCATGTCTGGACCAACAGTG -3'

Sequencing Primer
(F):5'- CAGCATCTTGGGTGTGGAGAC -3'
(R):5'- CAACAGTGGATGAAATTTGGATCCTG -3'
Posted On2017-02-10