Incidental Mutation 'R5879:Nlrc3'
ID455734
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene NameNLR family, CARD domain containing 3
SynonymsCLR16.2, Caterpiller 16.2, D230007K08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3945007-3976632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3964045 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 516 (F516S)
Ref Sequence ENSEMBL: ENSMUSP00000137628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163478
Predicted Effect probably damaging
Transcript: ENSMUST00000177551
AA Change: F516S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: F516S

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229884
AA Change: F500S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3955166 missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3965117 missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3963905 missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3947487 missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3953939 missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3964824 missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3949459 splice site probably benign
IGL02795:Nlrc3 APN 16 3965285 missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3964074 missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3954023 splice site probably benign
IGL03003:Nlrc3 APN 16 3964862 missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3964315 missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3958958 missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3965192 missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3948249 splice site probably benign
R0622:Nlrc3 UTSW 16 3953968 missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3948911 missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3965302 missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3963995 missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3965110 missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3963992 missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3953440 missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3952408 missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3947875 missense probably benign 0.22
R3843:Nlrc3 UTSW 16 3964964 missense probably benign
R4761:Nlrc3 UTSW 16 3963650 missense probably damaging 1.00
R5303:Nlrc3 UTSW 16 3963614 missense probably benign 0.15
R5375:Nlrc3 UTSW 16 3964753 missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3964035 missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3963725 missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3953995 missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3949429 missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3952444 missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3965074 missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3965081 missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3963753 missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3947877 missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3963590 missense probably damaging 0.99
R7477:Nlrc3 UTSW 16 3964811 missense probably damaging 0.99
R7817:Nlrc3 UTSW 16 3965463 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAAGCCTTGTAGGACCTCAG -3'
(R):5'- GAAGGCATTTGGAGTGGACCTC -3'

Sequencing Primer
(F):5'- TTGTAGGACCTCAGCCACCTG -3'
(R):5'- GACCTCGCTCTGTTGCAGAAC -3'
Posted On2017-02-10