Incidental Mutation 'R5879:Eml3'
ID455738
Institutional Source Beutler Lab
Gene Symbol Eml3
Ensembl Gene ENSMUSG00000071647
Gene Nameechinoderm microtubule associated protein like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8929552-8941582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8935015 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 392 (C392Y)
Ref Sequence ENSEMBL: ENSMUSP00000153500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096241] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096241
AA Change: C393Y

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647
AA Change: C393Y

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224272
AA Change: C392Y

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000224642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Eml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Eml3 APN 19 8936398 nonsense probably null
IGL01398:Eml3 APN 19 8934234 splice site probably benign
IGL01904:Eml3 APN 19 8936766 splice site probably benign
IGL02557:Eml3 APN 19 8931381 unclassified probably benign
IGL02795:Eml3 APN 19 8933778 missense probably benign 0.43
IGL03160:Eml3 APN 19 8934955 missense probably benign 0.04
IGL03172:Eml3 APN 19 8939179 unclassified probably benign
IGL03376:Eml3 APN 19 8933790 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0599:Eml3 UTSW 19 8939063 missense probably benign 0.14
R0652:Eml3 UTSW 19 8933285 missense probably damaging 1.00
R0827:Eml3 UTSW 19 8938466 missense probably damaging 0.98
R0841:Eml3 UTSW 19 8937685 missense probably benign
R0880:Eml3 UTSW 19 8940915 missense possibly damaging 0.92
R0924:Eml3 UTSW 19 8933311 critical splice donor site probably null
R1127:Eml3 UTSW 19 8936308 missense probably damaging 0.99
R1156:Eml3 UTSW 19 8934130 missense probably damaging 1.00
R1160:Eml3 UTSW 19 8933250 missense probably benign 0.00
R1427:Eml3 UTSW 19 8933861 missense probably damaging 1.00
R1497:Eml3 UTSW 19 8936369 missense probably damaging 1.00
R1679:Eml3 UTSW 19 8936637 missense probably damaging 0.98
R1931:Eml3 UTSW 19 8937143 missense probably benign 0.43
R2119:Eml3 UTSW 19 8934354 critical splice donor site probably null
R4296:Eml3 UTSW 19 8931409 missense probably damaging 1.00
R5122:Eml3 UTSW 19 8937696 critical splice donor site probably null
R5288:Eml3 UTSW 19 8939274 missense probably damaging 1.00
R5467:Eml3 UTSW 19 8937582 nonsense probably null
R5836:Eml3 UTSW 19 8941295 missense possibly damaging 0.96
R5845:Eml3 UTSW 19 8939218 missense probably damaging 1.00
R5881:Eml3 UTSW 19 8933443 missense probably damaging 1.00
R6011:Eml3 UTSW 19 8939107 missense probably damaging 1.00
R6247:Eml3 UTSW 19 8930949 missense probably benign
R6777:Eml3 UTSW 19 8936722 missense probably benign
R7132:Eml3 UTSW 19 8941028 missense probably benign 0.25
R7169:Eml3 UTSW 19 8933464 missense probably damaging 1.00
R7896:Eml3 UTSW 19 8933807 missense possibly damaging 0.96
R7979:Eml3 UTSW 19 8933807 missense possibly damaging 0.96
R8054:Eml3 UTSW 19 8939050 missense possibly damaging 0.77
X0025:Eml3 UTSW 19 8937439 missense probably damaging 0.96
Z1177:Eml3 UTSW 19 8937561 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAGTGTTCTGGGCTCACAC -3'
(R):5'- TATAGTCCCCGTTAGAACTCCTG -3'

Sequencing Primer
(F):5'- CACAGCCAGTTCTCCTGAG -3'
(R):5'- CTGTAGTTCCCAATGCACAGATGG -3'
Posted On2017-02-10