Incidental Mutation 'R5879:Loxl4'
ID455739
Institutional Source Beutler Lab
Gene Symbol Loxl4
Ensembl Gene ENSMUSG00000025185
Gene Namelysyl oxidase-like 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5879 (G1)
Quality Score189
Status Not validated
Chromosome19
Chromosomal Location42593982-42612813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42607627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000126552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026190] [ENSMUST00000164786] [ENSMUST00000166128] [ENSMUST00000171432]
Predicted Effect probably benign
Transcript: ENSMUST00000026190
AA Change: V129A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000026190
Gene: ENSMUSG00000025185
AA Change: V129A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164014
Predicted Effect probably benign
Transcript: ENSMUST00000164786
AA Change: V129A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125803
Gene: ENSMUSG00000025185
AA Change: V129A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 313 413 2.6e-41 SMART
SR 423 531 5.41e-30 SMART
Pfam:Lysyl_oxidase 535 735 1.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166128
AA Change: V142A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126552
Gene: ENSMUSG00000025185
AA Change: V142A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
SR 46 147 1.57e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171432
AA Change: V129A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126686
Gene: ENSMUSG00000025185
AA Change: V129A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 33 134 1.57e-49 SMART
SR 160 288 3.96e-14 SMART
SR 312 412 2.6e-41 SMART
SR 422 530 5.41e-30 SMART
Pfam:Lysyl_oxidase 534 737 1.3e-113 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Zc3h6 A G 2: 128,997,776 probably null Het
Other mutations in Loxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Loxl4 APN 19 42597549 missense probably damaging 1.00
IGL02063:Loxl4 APN 19 42608339 missense probably benign 0.03
IGL02490:Loxl4 APN 19 42604830 missense probably benign
IGL02498:Loxl4 APN 19 42604973 missense probably benign 0.27
IGL03107:Loxl4 APN 19 42605279 missense probably benign 0.12
IGL03296:Loxl4 APN 19 42598823 splice site probably benign
R1145:Loxl4 UTSW 19 42608555 unclassified probably benign
R1697:Loxl4 UTSW 19 42604940 missense possibly damaging 0.86
R2126:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2128:Loxl4 UTSW 19 42603963 missense probably damaging 1.00
R2148:Loxl4 UTSW 19 42604192 unclassified probably null
R2159:Loxl4 UTSW 19 42600007 missense probably damaging 1.00
R3624:Loxl4 UTSW 19 42607576 missense probably benign 0.28
R4030:Loxl4 UTSW 19 42608359 missense probably damaging 1.00
R4181:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4302:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4700:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4701:Loxl4 UTSW 19 42607613 missense probably benign 0.07
R4719:Loxl4 UTSW 19 42607591 missense probably benign 0.00
R4724:Loxl4 UTSW 19 42608346 missense probably benign 0.23
R4750:Loxl4 UTSW 19 42605004 missense probably damaging 1.00
R4953:Loxl4 UTSW 19 42610694 unclassified probably benign
R5579:Loxl4 UTSW 19 42604290 missense probably damaging 1.00
R5840:Loxl4 UTSW 19 42598715 missense probably damaging 1.00
R5856:Loxl4 UTSW 19 42595366 missense possibly damaging 0.89
R6137:Loxl4 UTSW 19 42598793 missense probably damaging 1.00
R6180:Loxl4 UTSW 19 42608352 missense probably damaging 1.00
R6324:Loxl4 UTSW 19 42595378 missense probably benign 0.00
R6347:Loxl4 UTSW 19 42608270 missense probably damaging 1.00
R6646:Loxl4 UTSW 19 42598781 missense probably damaging 1.00
R6788:Loxl4 UTSW 19 42608353 missense probably damaging 1.00
R7045:Loxl4 UTSW 19 42606635 missense probably damaging 1.00
R8013:Loxl4 UTSW 19 42607676 missense probably damaging 1.00
R8072:Loxl4 UTSW 19 42607582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGAGCAGTTTCTCAGG -3'
(R):5'- TGTCCCACCAGAGAGAAAGCAG -3'

Sequencing Primer
(F):5'- TGACTGGCTCTGCACGAATG -3'
(R):5'- GAGAAAGCAGCCTCTCTCG -3'
Posted On2017-02-10