Mutagenetix > Incidental Mutations

Incidental Mutation 'R5051:Ap3d1'

455744

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

042641-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.939) question?

Stock #

R5051 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 80719199 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 431 (T431P)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: T431P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: T431P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

probably benign
Transcript: ENSMUST00000219356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Meta Mutation Damage Score

0.2707

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.9%
20x: 90.6%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,691,986	N313K	possibly damaging	Het
5730522E02Rik	G	A	11: 25,768,990	T51I	unknown	Het
Alms1	C	T	6: 85,627,934	Q2189*	probably null	Het
Ank1	A	T	8: 23,119,381	D1363V	probably damaging	Het
Arnt	A	G	3: 95,470,337	T125A	probably benign	Het
Atp10a	TGTCCGTC	TGTC	7: 58,740,246		probably null	Het
Bscl2	A	T	19: 8,845,279	R195*	probably null	Het
Ccdc146	C	T	5: 21,303,083	V656I	possibly damaging	Het
Ccr4	T	C	9: 114,492,646	Y117C	probably damaging	Het
Cd55	T	A	1: 130,448,348	D355V	probably damaging	Het
Cntn6	T	A	6: 104,772,597	I259N	probably damaging	Het
Cspg4	A	G	9: 56,885,736	I252V	possibly damaging	Het
Dmbt1	T	C	7: 131,094,742	V895A	probably benign	Het
Ect2	A	G	3: 27,102,486	V775A	probably benign	Het
Gm14486	T	C	2: 30,658,877		noncoding transcript	Het
Grin2b	T	C	6: 135,779,395	N444S	possibly damaging	Het
Heatr5b	T	C	17: 78,795,274	D1225G	probably damaging	Het
Il1rl2	G	A	1: 40,343,094	V189I	probably benign	Het
Kif1a	G	A	1: 93,076,154		probably null	Het
Ltbr	T	A	6: 125,312,770	T154S	probably damaging	Het
Mrgpra6	C	T	7: 47,185,942	V244I	probably benign	Het
Myo15	G	A	11: 60,487,425		probably null	Het
Ndufs1	A	G	1: 63,164,947		probably null	Het
Nectin3	A	T	16: 46,448,550	N496K	possibly damaging	Het
Nkd2	A	G	13: 73,825,076	V147A	probably benign	Het
Nlrp3	G	C	11: 59,566,199	R1013P	probably benign	Het
Olfr1280	T	A	2: 111,316,254	Y258*	probably null	Het
Olfr1423	C	A	19: 12,035,924	V273F	possibly damaging	Het
Pdk2	T	C	11: 95,028,772	S263G	probably benign	Het
Pla2g4e	T	A	2: 120,174,304	I520F	probably damaging	Het
Plat	A	G	8: 22,773,672	T196A	probably benign	Het
Podn	T	A	4: 108,014,846	D400V	probably benign	Het
Poteg	T	C	8: 27,453,329	V147A	possibly damaging	Het
Prkar2a	A	G	9: 108,745,491	N315D	probably benign	Het
Rac2	A	G	15: 78,564,934	I13T	possibly damaging	Het
Rangap1	A	C	15: 81,710,463	D388E	probably benign	Het
Sp140	T	A	1: 85,610,828	D95E	possibly damaging	Het
Supv3l1	A	C	10: 62,443,417	I240S	probably damaging	Het
Sympk	C	T	7: 19,036,042	R215C	probably benign	Het
Tead4	A	C	6: 128,294,299		probably benign	Het
Tex10	G	A	4: 48,460,019	A444V	possibly damaging	Het
Tgds	A	T	14: 118,128,227	I73K	probably damaging	Het
Tmem117	C	A	15: 94,714,913	T110K	probably damaging	Het
Trim30a	T	A	7: 104,411,706		probably benign	Het
Unc80	C	T	1: 66,509,477	T636I	probably damaging	Het
Wisp3	A	G	10: 39,155,156	F124L	probably benign	Het
Ybey	G	A	10: 76,468,339	R10W	probably damaging	Het
Zap70	A	G	1: 36,781,451	I576V	probably benign	Het
Zfp64	T	C	2: 168,926,384	D436G	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATCCAGGCAGCAGCATAGAG -3'
(R):5'- GGGCTCATGAGTTCCATCTTG -3'

Sequencing Primer
(F):5'- TAGAGCACCTCACAGATACCATTG -3'
(R):5'- TGTTCCCCACAGGTGTCCAAG -3'

Posted On

2017-02-13