Incidental Mutation 'R5096:Iqsec3'
ID455751
Institutional Source Beutler Lab
Gene Symbol Iqsec3
Ensembl Gene ENSMUSG00000040797
Gene NameIQ motif and Sec7 domain 3
SynonymssynarfGEF, BRAG3
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5096 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121372933-121473678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121386698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 866 (V866M)
Ref Sequence ENSEMBL: ENSMUSP00000038653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046373] [ENSMUST00000129815] [ENSMUST00000152103]
Predicted Effect probably damaging
Transcript: ENSMUST00000046373
AA Change: V866M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038653
Gene: ENSMUSG00000040797
AA Change: V866M

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Blast:Sec7 285 354 5e-16 BLAST
low complexity region 367 386 N/A INTRINSIC
Blast:Sec7 476 507 2e-9 BLAST
low complexity region 508 531 N/A INTRINSIC
low complexity region 542 594 N/A INTRINSIC
low complexity region 598 628 N/A INTRINSIC
Sec7 652 843 9.53e-89 SMART
PH 874 985 4.03e0 SMART
low complexity region 1065 1105 N/A INTRINSIC
low complexity region 1126 1144 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
low complexity region 1182 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129815
SMART Domains Protein: ENSMUSP00000120847
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152103
SMART Domains Protein: ENSMUSP00000116317
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Meta Mutation Damage Score 0.2761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Gm10715 T C 9: 3,038,157 probably benign Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Iqsec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Iqsec3 APN 6 121473124 missense possibly damaging 0.90
IGL01615:Iqsec3 APN 6 121410621 missense probably damaging 1.00
IGL01728:Iqsec3 APN 6 121412664 utr 3 prime probably benign
IGL01935:Iqsec3 APN 6 121383992 missense probably damaging 1.00
IGL02146:Iqsec3 APN 6 121383957 missense probably damaging 0.99
IGL02369:Iqsec3 APN 6 121412934 utr 3 prime probably benign
IGL02684:Iqsec3 APN 6 121412941 nonsense probably null
IGL03180:Iqsec3 APN 6 121413508 utr 3 prime probably benign
R0032:Iqsec3 UTSW 6 121473130 missense possibly damaging 0.71
R0088:Iqsec3 UTSW 6 121473289 missense probably damaging 0.97
R0189:Iqsec3 UTSW 6 121413562 utr 3 prime probably benign
R0193:Iqsec3 UTSW 6 121410724 missense probably damaging 1.00
R0528:Iqsec3 UTSW 6 121412784 utr 3 prime probably benign
R1885:Iqsec3 UTSW 6 121428367 intron probably benign
R2698:Iqsec3 UTSW 6 121413471 utr 3 prime probably benign
R3751:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3753:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3947:Iqsec3 UTSW 6 121387824 nonsense probably null
R3948:Iqsec3 UTSW 6 121387824 nonsense probably null
R3949:Iqsec3 UTSW 6 121387824 nonsense probably null
R4006:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4007:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4210:Iqsec3 UTSW 6 121413040 utr 3 prime probably benign
R4535:Iqsec3 UTSW 6 121380018 missense possibly damaging 0.80
R4567:Iqsec3 UTSW 6 121387762 missense probably damaging 1.00
R5135:Iqsec3 UTSW 6 121383919 missense probably damaging 1.00
R5289:Iqsec3 UTSW 6 121386700 critical splice acceptor site probably null
R5537:Iqsec3 UTSW 6 121412644 utr 3 prime probably benign
R6555:Iqsec3 UTSW 6 121384219 missense probably damaging 1.00
R6942:Iqsec3 UTSW 6 121473103 missense probably damaging 1.00
R7122:Iqsec3 UTSW 6 121473358 missense unknown
R7372:Iqsec3 UTSW 6 121384032 nonsense probably null
R7394:Iqsec3 UTSW 6 121386610 missense possibly damaging 0.47
R7559:Iqsec3 UTSW 6 121387780 missense probably damaging 1.00
R7729:Iqsec3 UTSW 6 121383981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGCACCAGCTTCAGTTAC -3'
(R):5'- ACAGGCATAATGAGTCCTTTCTC -3'

Sequencing Primer
(F):5'- AGTTACCCCCTTCCCTGG -3'
(R):5'- TCTCTGAGAATGCTGCCCTAGAG -3'
Posted On2017-02-13