Incidental Mutation 'R5119:Spag9'
ID455760
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
MMRRC Submission 042707-MU
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R5119 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94122722 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1127 (G1127D)
Ref Sequence ENSEMBL: ENSMUSP00000099457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000153076]
Predicted Effect probably damaging
Transcript: ENSMUST00000024979
AA Change: G1132D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: G1132D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041956
AA Change: G1270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: G1270D

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075695
AA Change: G1131D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: G1131D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092777
AA Change: G1132D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: G1132D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103168
AA Change: G1127D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: G1127D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153076
AA Change: G864D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: G864D

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Meta Mutation Damage Score 0.1431 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (127/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik C A 2: 170,579,585 G125V unknown Het
Actr6 A T 10: 89,725,855 L143Q probably damaging Het
Adamts18 A G 8: 113,699,010 Y1207H probably benign Het
Adamts5 T A 16: 85,899,578 R230S probably benign Het
Adat2 A T 10: 13,556,906 N51Y probably damaging Het
Adgrv1 T C 13: 81,419,427 Y5209C possibly damaging Het
Ahnak G T 19: 9,013,644 M4097I probably benign Het
Akap13 A G 7: 75,687,252 T820A probably damaging Het
Als2cl C T 9: 110,890,819 R492C probably damaging Het
Aox3 G A 1: 58,188,524 probably null Het
Arid4b G A 13: 14,164,281 V446M probably benign Het
Armc2 A G 10: 41,922,148 L794P probably damaging Het
Atp6v0a1 T A 11: 101,020,515 M80K probably benign Het
Aup1 T C 6: 83,055,134 V94A probably damaging Het
Bank1 A T 3: 136,234,682 I180K possibly damaging Het
Becn1 A G 11: 101,291,395 L116P probably damaging Het
Bsg A G 10: 79,710,223 probably benign Het
Camk2a A T 18: 60,943,136 probably benign Het
Ccdc180 A G 4: 45,914,603 E706G possibly damaging Het
Cdk8 A T 5: 146,283,627 probably null Het
Cpne4 A G 9: 104,901,521 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Cyp2c38 C A 19: 39,460,621 G96V probably damaging Het
Dhx40 A G 11: 86,776,636 I261T probably damaging Het
Dnah10 T C 5: 124,779,258 F2038L probably damaging Het
Dnah7a A T 1: 53,698,692 D27E probably benign Het
Dock10 A T 1: 80,567,994 probably null Het
Dst A T 1: 34,195,969 K3710* probably null Het
Dtl G T 1: 191,541,506 A430D probably damaging Het
Ece2 T C 16: 20,618,631 L241P probably damaging Het
Ecel1 T A 1: 87,151,139 Y526F probably benign Het
Enpp2 T A 15: 54,870,305 R420* probably null Het
Epb41 A C 4: 131,937,436 probably benign Het
Eppin T C 2: 164,589,451 Y85C probably damaging Het
Fam171a2 G A 11: 102,438,733 A400V probably damaging Het
Fam71b G A 11: 46,407,036 G389D probably damaging Het
Fem1c A C 18: 46,506,369 C189G probably damaging Het
Frmd4b A G 6: 97,300,314 V560A probably benign Het
Fsip2 A T 2: 82,988,191 D4756V probably damaging Het
Gabbr1 T C 17: 37,048,438 S102P probably damaging Het
Gm28042 G A 2: 120,034,643 A250T probably damaging Het
Gm42877 T C 14: 54,075,521 probably benign Het
Gm9762 A T 3: 78,966,400 noncoding transcript Het
Gpr183 G T 14: 121,954,863 T82N possibly damaging Het
Gps2 A G 11: 69,914,791 K45R probably benign Het
Gramd2 A G 9: 59,714,320 probably benign Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Hsdl1 T A 8: 119,565,867 Y203F possibly damaging Het
Ifi204 A T 1: 173,755,668 I328N probably damaging Het
Igsf3 T A 3: 101,439,361 probably null Het
Il1rap T C 16: 26,624,199 I15T probably benign Het
Il23r A T 6: 67,466,316 C268S probably damaging Het
Irx4 A G 13: 73,268,921 T479A probably benign Het
Kcnk7 G A 19: 5,706,324 V193I probably benign Het
Kcnt1 G T 2: 25,909,322 probably benign Het
Kif13b T G 14: 64,757,453 C885G probably benign Het
Kif21b C A 1: 136,163,100 D1215E probably benign Het
Klhdc2 A G 12: 69,296,962 probably benign Het
Kmt2d G A 15: 98,847,194 probably benign Het
Lama4 A G 10: 39,048,054 N486S probably benign Het
Ldah G A 12: 8,227,237 A58T probably benign Het
Lrrc24 T C 15: 76,716,000 Q313R probably benign Het
Luzp1 A G 4: 136,543,397 D977G possibly damaging Het
Mrgpra4 A G 7: 47,981,718 L45P probably damaging Het
Mrps28 C T 3: 8,923,696 G34D possibly damaging Het
Myh8 A G 11: 67,298,358 E1120G probably damaging Het
Myt1l A G 12: 29,832,303 E499G unknown Het
Ncan C T 8: 70,115,025 E146K probably damaging Het
Nlgn1 A T 3: 25,433,794 D763E probably damaging Het
Olfr1259 A T 2: 89,943,803 I104N possibly damaging Het
Olfr1474 C T 19: 13,471,546 T192I probably benign Het
Olfr157 G T 4: 43,836,433 A19D probably benign Het
Olfr23 A T 11: 73,940,552 Y102F possibly damaging Het
Olfr742 T C 14: 50,515,509 F102L probably benign Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pak6 A T 2: 118,694,548 I552F probably damaging Het
Pcbp1 G A 6: 86,524,915 A334V probably damaging Het
Pclaf T C 9: 65,890,780 V32A probably benign Het
Pga5 T A 19: 10,676,689 H50L probably benign Het
Phyhipl A T 10: 70,569,074 D56E probably damaging Het
Pik3ap1 C T 19: 41,281,976 R758H probably benign Het
Plekha1 A G 7: 130,905,364 probably benign Het
Plekhm1 A T 11: 103,387,315 N318K possibly damaging Het
Ppargc1b G A 18: 61,307,654 A731V probably benign Het
Pptc7 T C 5: 122,313,781 V100A possibly damaging Het
Prl7a1 A T 13: 27,633,581 H233Q possibly damaging Het
Prpf40a A G 2: 53,144,849 F776L probably damaging Het
Prrc2c T C 1: 162,705,440 probably benign Het
Psmb1 T C 17: 15,498,262 M1V probably null Het
Ptpn3 A G 4: 57,218,513 F650S possibly damaging Het
Ranbp17 A T 11: 33,404,181 *577R probably null Het
Reln T A 5: 21,971,870 N1933Y probably benign Het
Rgl2 T A 17: 33,937,120 H727Q probably benign Het
Rhpn2 A G 7: 35,371,124 T160A probably damaging Het
Rlf G A 4: 121,147,455 H1443Y probably damaging Het
Rpgrip1l T C 8: 91,280,816 E382G probably damaging Het
Rxrb T C 17: 34,033,588 S50P probably benign Het
Scn4b A T 9: 45,147,758 E109V probably damaging Het
Scrib C T 15: 76,051,753 probably null Het
Slc22a29 A T 19: 8,217,830 V147D probably damaging Het
Slc4a4 A T 5: 88,954,862 E53V probably null Het
Slx4 A G 16: 4,001,199 S37P possibly damaging Het
Srek1 T A 13: 103,752,556 probably benign Het
Supt5 G T 7: 28,316,370 P849Q probably damaging Het
Tex14 T C 11: 87,433,813 S2P probably damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Tldc1 A C 8: 119,768,143 L292R probably damaging Het
Tll2 A G 19: 41,130,509 V260A possibly damaging Het
Tlr6 A G 5: 64,954,301 V421A probably benign Het
Tmc3 T G 7: 83,615,010 C649G probably damaging Het
Tnn A G 1: 160,120,552 W864R probably damaging Het
Tsc2 A C 17: 24,603,280 V1095G probably benign Het
Vmn1r124 C T 7: 21,260,247 G124D probably damaging Het
Vmn2r116 T C 17: 23,387,164 V350A probably benign Het
Vps13d A G 4: 145,105,898 S2813P possibly damaging Het
Wrap53 T A 11: 69,563,932 M204L possibly damaging Het
Zfp277 A G 12: 40,328,688 V390A possibly damaging Het
Zfp687 A T 3: 95,011,676 S262T probably benign Het
Zfp831 T A 2: 174,705,310 S1429T probably benign Het
Znfx1 G A 2: 167,065,387 probably benign Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94114351 critical splice donor site probably null
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense probably benign
R7179:Spag9 UTSW 11 94089432 intron probably null
R7225:Spag9 UTSW 11 94097358 missense probably damaging 0.98
R7351:Spag9 UTSW 11 94092976 missense probably benign 0.00
R7366:Spag9 UTSW 11 94108521 missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94114351 critical splice donor site probably null
R7401:Spag9 UTSW 11 94097689 missense probably benign
R7506:Spag9 UTSW 11 94108464 missense probably damaging 1.00
R7507:Spag9 UTSW 11 94068080 missense probably benign 0.00
R7513:Spag9 UTSW 11 94112083 missense probably damaging 1.00
R7655:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93996563 missense possibly damaging 0.56
R7664:Spag9 UTSW 11 94102160 critical splice donor site probably null
R7665:Spag9 UTSW 11 94013654 missense probably damaging 0.98
R7862:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7945:Spag9 UTSW 11 94112066 missense possibly damaging 0.69
R7963:Spag9 UTSW 11 94071834 splice site probably null
R8074:Spag9 UTSW 11 94112051 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAGCATACTATTGTGAACTAGC -3'
(R):5'- CAGTAAACTAGCTCGCTCCTC -3'

Sequencing Primer
(F):5'- ATGGCTATGAGCTGCCTAAC -3'
(R):5'- GCTCCTCTGTATTGTTACCATAGAAC -3'
Posted On2017-02-13