Incidental Mutation 'R4908:Lasp1'
ID455816
Institutional Source Beutler Lab
Gene Symbol Lasp1
Ensembl Gene ENSMUSG00000038366
Gene NameLIM and SH3 protein 1
SynonymsTg(Col1a1-lacZ)1Ngma, Def-4, Tg(11Col1a1)NG, SH3P6
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4908 (G1)
Quality Score97
Status Not validated
Chromosome11
Chromosomal Location97799000-97838764 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 97833704 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000146572] [ENSMUST00000148280] [ENSMUST00000152962]
Predicted Effect probably null
Transcript: ENSMUST00000043843
SMART Domains Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
LIM 4 56 4.34e-15 SMART
NEBU 62 92 1.1e-8 SMART
NEBU 98 128 1.05e-9 SMART
low complexity region 174 180 N/A INTRINSIC
SH3 207 263 8.11e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127575
Predicted Effect probably benign
Transcript: ENSMUST00000129558
SMART Domains Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129828
SMART Domains Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146572
SMART Domains Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
Pfam:Nebulin 31 59 2.1e-12 PFAM
Pfam:Nebulin 67 89 1.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148280
SMART Domains Protein: ENSMUSP00000123050
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
low complexity region 138 144 N/A INTRINSIC
SCOP:d1awj__ 155 186 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152962
SMART Domains Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Lasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Lasp1 APN 11 97836190 missense probably damaging 1.00
R0281:Lasp1 UTSW 11 97806851 nonsense probably null
R2126:Lasp1 UTSW 11 97836134 missense probably benign 0.34
R3906:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3908:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3909:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R5239:Lasp1 UTSW 11 97799860 missense probably damaging 1.00
R6519:Lasp1 UTSW 11 97815557 splice site probably null
R6576:Lasp1 UTSW 11 97833576 missense probably damaging 1.00
R6629:Lasp1 UTSW 11 97806896 nonsense probably null
R7001:Lasp1 UTSW 11 97806833 missense probably damaging 1.00
R8063:Lasp1 UTSW 11 97834131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACTGGTTGGCTCGCAAC -3'
(R):5'- TTCATGCCAGGGCTGTATG -3'

Sequencing Primer
(F):5'- TTGGCTCGCAACGGAAC -3'
(R):5'- GGCTGTATGCTCCTCACACATAAATC -3'
Posted On2017-02-14