Incidental Mutation 'R4860:Ulk4'
ID 455825
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R4860 (G1)
Quality Score 73
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121079968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 497 (T497M)
Ref Sequence ENSEMBL: ENSMUSP00000129214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000051479
AA Change: T497M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: T497M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect possibly damaging
Transcript: ENSMUST00000171061
AA Change: T497M

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: T497M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: T497M

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: T497M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172397
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 94% (98/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akap9 G A 5: 4,084,916 (GRCm39) probably benign Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dnd1 C T 18: 36,899,016 (GRCm39) probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Grm6 C T 11: 50,755,439 (GRCm39) T857M probably benign Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Ilkap A G 1: 91,315,105 (GRCm39) probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl22 G A 16: 17,594,880 (GRCm39) silent Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Krr1 C T 10: 111,821,596 (GRCm39) probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nsmce4a A T 7: 130,135,321 (GRCm39) probably benign Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pik3r6 T A 11: 68,434,879 (GRCm39) probably benign Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Snapc3 C T 4: 83,383,134 (GRCm39) probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tango2 A G 16: 18,128,765 (GRCm39) silent Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp384 G A 6: 125,007,893 (GRCm39) silent Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGTTCTACTACTGAGCTGATC -3'
(R):5'- ACATGGTTATGTCTCCCTGGG -3'

Sequencing Primer
(F):5'- ACTGAGCTGATCATCACTCGG -3'
(R):5'- ACTGGATGTCTGCTCAGCC -3'
Posted On 2017-02-14