Incidental Mutation 'R0556:Clec16a'
ID45587
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission 038748-MU
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0556 (G1)
Quality Score130
Status Validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 10638785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038145] [ENSMUST00000066345] [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115824] [ENSMUST00000115827] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably null
Transcript: ENSMUST00000038145
SMART Domains Protein: ENSMUSP00000040267
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 9.2e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
low complexity region 897 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066345
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066345
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115823
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115823
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115824
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115824
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115827
SMART Domains Protein: ENSMUSP00000111493
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 8.7e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145866
Predicted Effect probably null
Transcript: ENSMUST00000155633
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 unclassified probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTGTGAAACCAGTGCCAAGAAC -3'
(R):5'- CGTGAGGCTATTCTTTCCAGGTGAC -3'

Sequencing Primer
(F):5'- GCCTCTGGAAAACAGTGTTAAAC -3'
(R):5'- TCCAGGTGACTAGACACCTATTG -3'
Posted On2013-06-11