Incidental Mutation 'R0556:1600012H06Rik'
ID45590
Institutional Source Beutler Lab
Gene Symbol 1600012H06Rik
Ensembl Gene ENSMUSG00000050088
Gene NameRIKEN cDNA 1600012H06 gene
Synonyms
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0556 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14943184-14959570 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 14943951 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 113 (Y113*)
Ref Sequence ENSEMBL: ENSMUSP00000133628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000052691] [ENSMUST00000164837] [ENSMUST00000168938] [ENSMUST00000174004] [ENSMUST00000228330]
Predicted Effect probably benign
Transcript: ENSMUST00000024657
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000052691
AA Change: Y113*
SMART Domains Protein: ENSMUSP00000093344
Gene: ENSMUSG00000050088
AA Change: Y113*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164837
AA Change: Y113*
SMART Domains Protein: ENSMUSP00000125970
Gene: ENSMUSG00000050088
AA Change: Y113*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168938
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172650
Predicted Effect probably null
Transcript: ENSMUST00000174004
AA Change: Y113*
SMART Domains Protein: ENSMUSP00000133628
Gene: ENSMUSG00000050088
AA Change: Y113*

DomainStartEndE-ValueType
Pfam:UPF0669 1 185 7e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228869
Predicted Effect probably benign
Transcript: ENSMUST00000228330
Meta Mutation Damage Score 0.9647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved, N-glycosylated protein that likely functions in the cellular response to endoplasmic reticulum stress. This protein is able to induce apoptosis in vitro in CD4+ T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Mau2 G C 8: 70,042,432 T85R probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in 1600012H06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:1600012H06Rik APN 17 14943919 splice site probably null
IGL01606:1600012H06Rik APN 17 14943863 missense probably damaging 1.00
IGL01845:1600012H06Rik APN 17 14944118 missense probably damaging 1.00
ANU18:1600012H06Rik UTSW 17 14943919 splice site probably null
R1983:1600012H06Rik UTSW 17 14944010 missense probably damaging 0.99
R4841:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
R4842:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
R7504:1600012H06Rik UTSW 17 14943653 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGGTGGTGACCCTGGTAAAATG -3'
(R):5'- AGAGAACTGATTCCTCCTCTTGGGC -3'

Sequencing Primer
(F):5'- ACAGCTACTTGCGGTTGAAC -3'
(R):5'- CTGCCTCTTCTGGAGCGTAAG -3'
Posted On2013-06-11