Incidental Mutation 'R0557:Olfr350'
ID 45599
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission 038749-MU
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R0557 (G1)
Quality Score 214
Status Not validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36850748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 234 (I234N)
Ref Sequence ENSEMBL: ENSMUSP00000149667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect possibly damaging
Transcript: ENSMUST00000055130
AA Change: I234N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: I234N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214457
AA Change: I234N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215100
AA Change: I234N

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAACCTGCTCATCATCCTAC -3'
(R):5'- TTCAGCAATGGAGTGACCACTGTG -3'

Sequencing Primer
(F):5'- GTCACTGTACCCAAGATGCTG -3'
(R):5'- TGTACATCACAGAAGCAACTATGC -3'
Posted On 2013-06-11