Mutagenetix > Incidental Mutations

Incidental Mutation 'R0557:Xirp2'

45601

Institutional Source

Beutler Lab

Gene Symbol

Xirp2

Ensembl Gene

ENSMUSG00000027022

Gene Name

xin actin-binding repeat containing 2

Synonyms

2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta

MMRRC Submission

038749-MU

Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198

Is this an essential gene?

Possibly non essential (E-score: 0.311) question?

Stock #

R0557 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67446002-67526614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67516351 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2979 (T2979A)

Ref Sequence

ENSEMBL: ENSMUSP00000107966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]

Predicted Effect

probably benign
Transcript: ENSMUST00000028410
AA Change: T2979A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: T2979A

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4e-9	PFAM
Pfam:Xin	384	398	7.6e-10	PFAM
Pfam:Xin	420	435	6.4e-9	PFAM
Pfam:Xin	458	473	5.3e-9	PFAM
Pfam:Xin	536	551	4.1e-12	PFAM
Pfam:Xin	574	588	2.1e-8	PFAM
Pfam:Xin	609	623	6e-9	PFAM
Pfam:Xin	642	656	5.6e-8	PFAM
Pfam:Xin	679	693	5.9e-8	PFAM
Pfam:Xin	784	799	1.1e-10	PFAM
Pfam:Xin	822	837	3.9e-11	PFAM
Pfam:Xin	861	875	8.6e-12	PFAM
Pfam:Xin	894	909	2.8e-10	PFAM
Pfam:Xin	1006	1021	3.1e-9	PFAM
Pfam:Xin	1079	1094	6.7e-10	PFAM
Pfam:Xin	1117	1132	1.5e-10	PFAM
Pfam:Xin	1154	1169	2.4e-8	PFAM
Pfam:Xin	1256	1271	4.6e-8	PFAM
Pfam:Xin	1292	1305	1.6e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC
LIM	3256	3308	4.45e-12	SMART
low complexity region	3356	3367	N/A	INTRINSIC
low complexity region	3549	3565	N/A	INTRINSIC
low complexity region	3614	3625	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112347
AA Change: T2979A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: T2979A

Domain	Start	End	E-Value	Type
low complexity region	176	188	N/A	INTRINSIC
low complexity region	194	208	N/A	INTRINSIC
low complexity region	289	298	N/A	INTRINSIC
Pfam:Xin	343	358	4.3e-8	PFAM
Pfam:Xin	383	398	6.9e-9	PFAM
Pfam:Xin	420	435	1.8e-8	PFAM
Pfam:Xin	458	473	6.9e-8	PFAM
Pfam:Xin	536	551	2.8e-10	PFAM
Pfam:Xin	608	623	2.4e-8	PFAM
Pfam:Xin	642	657	1.7e-7	PFAM
Pfam:Xin	784	799	3.5e-9	PFAM
Pfam:Xin	822	837	8.9e-10	PFAM
Pfam:Xin	861	876	3.9e-10	PFAM
Pfam:Xin	894	909	5.4e-9	PFAM
Pfam:Xin	1006	1021	6.2e-8	PFAM
Pfam:Xin	1079	1094	2.4e-8	PFAM
Pfam:Xin	1117	1132	9.5e-9	PFAM
Pfam:Xin	1291	1306	5.8e-8	PFAM
low complexity region	1314	1325	N/A	INTRINSIC
low complexity region	1547	1559	N/A	INTRINSIC
coiled coil region	1683	1704	N/A	INTRINSIC
low complexity region	1862	1871	N/A	INTRINSIC
low complexity region	2031	2043	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2087	2093	N/A	INTRINSIC
low complexity region	2105	2123	N/A	INTRINSIC
low complexity region	2159	2177	N/A	INTRINSIC
coiled coil region	2288	2311	N/A	INTRINSIC
coiled coil region	2738	2767	N/A	INTRINSIC
low complexity region	2794	2804	N/A	INTRINSIC
low complexity region	2906	2919	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142314

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,067,685	H266Y	probably damaging	Het
Abi3bp	C	T	16: 56,668,387	R1294C	probably damaging	Het
Acot3	T	C	12: 84,058,856	Y366H	probably damaging	Het
Ago1	A	G	4: 126,460,024	V254A	probably benign	Het
Ahnak	T	A	19: 9,001,944	D197E	probably benign	Het
Aldh1b1	A	T	4: 45,802,647	T62S	probably benign	Het
Alox12e	T	C	11: 70,321,448	R135G	possibly damaging	Het
Amn1	T	C	6: 149,171,005	Y78C	possibly damaging	Het
Ankmy2	G	A	12: 36,187,766	S288N	probably benign	Het
Ano3	A	T	2: 110,862,952		probably null	Het
Arfgap3	T	C	15: 83,303,185	D491G	probably damaging	Het
Arhgap15	T	C	2: 44,116,617	S249P	possibly damaging	Het
Atp9b	A	G	18: 80,765,922	V211A	probably damaging	Het
Cabin1	A	G	10: 75,726,917	Y12H	probably damaging	Het
Cdkn2aip	T	C	8: 47,712,942	T110A	probably damaging	Het
Chchd6	A	G	6: 89,574,587	S31P	probably damaging	Het
Chrna3	A	G	9: 55,015,865	Y220H	probably damaging	Het
Ctu1	A	G	7: 43,677,159	D414G	unknown	Het
Cxxc1	C	T	18: 74,218,774	R241W	possibly damaging	Het
Cyp3a16	A	G	5: 145,469,588	I18T	unknown	Het
Dip2c	A	T	13: 9,553,459	I405F	possibly damaging	Het
Disp3	A	T	4: 148,241,404	M1299K	possibly damaging	Het
Dnah9	T	G	11: 66,084,666	H1519P	probably damaging	Het
Ehd3	C	A	17: 73,829,933	Q366K	probably benign	Het
Exosc3	A	T	4: 45,316,957	M232K	probably damaging	Het
Fam196a	A	G	7: 134,918,705	L32P	probably damaging	Het
Fancm	T	C	12: 65,118,442		probably null	Het
Fgfr2	A	G	7: 130,219,081	V241A	probably damaging	Het
Gdf2	C	T	14: 33,941,221	P24L	probably damaging	Het
Hars2	T	C	18: 36,791,077	I489T	possibly damaging	Het
Ice1	T	C	13: 70,601,191	I1945V	probably benign	Het
Il33	A	C	19: 29,954,636	N143T	probably damaging	Het
Ilvbl	G	A	10: 78,583,487	W313*	probably null	Het
Isca1	G	T	13: 59,756,974	Q91K	possibly damaging	Het
Kcnh5	T	A	12: 75,114,549	Y195F	probably damaging	Het
Lama4	T	G	10: 39,088,397	I1355S	probably benign	Het
Lonrf1	T	C	8: 36,230,420	D470G	probably benign	Het
Mak	A	G	13: 41,039,659	Y446H	probably benign	Het
Mki67	C	T	7: 135,699,261	S1348N	possibly damaging	Het
Mpzl3	A	G	9: 45,066,508	Y138C	probably damaging	Het
Myh8	T	C	11: 67,301,798	L1501P	possibly damaging	Het
Naa35	A	G	13: 59,627,964	E552G	probably damaging	Het
Ncor2	A	T	5: 125,106,305	L200*	probably null	Het
Nrm	T	C	17: 35,864,632	V210A	probably damaging	Het
Nt5e	T	A	9: 88,366,466	N405K	probably damaging	Het
Olfr108	T	A	17: 37,445,821	I100N	probably damaging	Het
Olfr350	T	A	2: 36,850,748	I234N	possibly damaging	Het
Orc2	T	C	1: 58,469,687	S434G	probably damaging	Het
Plcb4	G	A	2: 135,954,349	V388I	probably damaging	Het
Ppm1l	A	G	3: 69,497,901	D177G	probably benign	Het
Prl8a2	A	T	13: 27,352,892	R165*	probably null	Het
Ptbp3	G	A	4: 59,517,684	R66*	probably null	Het
Pten	A	G	19: 32,817,890	T286A	probably benign	Het
Rac2	C	T	15: 78,564,974	V113M	probably damaging	Het
Rai1	C	T	11: 60,190,495	T1795I	probably benign	Het
Ros1	T	G	10: 52,085,263	K1792Q	possibly damaging	Het
Sema6a	A	G	18: 47,249,500	V660A	probably benign	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc26a5	A	G	5: 21,819,764	S441P	probably damaging	Het
Slc27a3	A	G	3: 90,386,856	L462P	probably damaging	Het
Spag5	T	A	11: 78,314,211	S607R	probably damaging	Het
Spata18	A	T	5: 73,651,670	N29Y	probably damaging	Het
Spata20	C	T	11: 94,485,222	R22H	probably benign	Het
Spsb2	A	C	6: 124,810,392	Y263S	probably damaging	Het
Sptbn4	C	A	7: 27,408,328	E885*	probably null	Het
Syne2	T	C	12: 75,929,301	I1175T	probably benign	Het
Tmem2	C	T	19: 21,811,903	A567V	probably benign	Het
Tmem209	A	C	6: 30,501,914	H253Q	probably damaging	Het
Trip12	A	T	1: 84,724,747	D788E	probably damaging	Het
Usp34	T	C	11: 23,403,848	S1509P	probably damaging	Het
Utp20	A	T	10: 88,748,311	D2661E	probably damaging	Het
Vars	C	A	17: 35,004,984	P264Q	possibly damaging	Het
Vmn2r66	T	G	7: 84,994,764	S813R	probably damaging	Het
Wipf2	C	A	11: 98,892,089	Q114K	possibly damaging	Het
Wnt5b	G	T	6: 119,433,818	H220Q	probably damaging	Het
Zfyve9	A	G	4: 108,674,511	V408A	probably damaging	Het
Zzef1	T	C	11: 72,917,730	S2744P	probably damaging	Het

Other mutations in Xirp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Xirp2	APN	2	67513375	missense	probably benign	0.37
IGL00336:Xirp2	APN	2	67512598	missense	possibly damaging	0.93
IGL00596:Xirp2	APN	2	67514882	missense	probably benign	0.08
IGL00862:Xirp2	APN	2	67516903	missense	probably benign	0.00
IGL01124:Xirp2	APN	2	67508615	missense	probably damaging	0.99
IGL01289:Xirp2	APN	2	67513181	missense	probably damaging	0.99
IGL01293:Xirp2	APN	2	67515184	missense	possibly damaging	0.51
IGL01372:Xirp2	APN	2	67513990	missense	possibly damaging	0.93
IGL01385:Xirp2	APN	2	67509677	missense	probably damaging	0.99
IGL01411:Xirp2	APN	2	67514083	missense	probably benign	0.00
IGL01413:Xirp2	APN	2	67509926	missense	probably damaging	1.00
IGL01551:Xirp2	APN	2	67513505	missense	probably benign
IGL01672:Xirp2	APN	2	67508502	missense	probably benign
IGL01724:Xirp2	APN	2	67526067	missense	probably benign
IGL01739:Xirp2	APN	2	67515138	missense	probably benign	0.15
IGL01807:Xirp2	APN	2	67515031	missense	probably benign
IGL02006:Xirp2	APN	2	67511962	missense	possibly damaging	0.85
IGL02030:Xirp2	APN	2	67508981	missense	probably benign	0.06
IGL02066:Xirp2	APN	2	67526071	missense	probably benign
IGL02138:Xirp2	APN	2	67516956	missense	probably benign	0.15
IGL02250:Xirp2	APN	2	67514012	missense	probably benign	0.03
IGL02265:Xirp2	APN	2	67517150	missense	possibly damaging	0.94
IGL02274:Xirp2	APN	2	67508651	missense	probably benign	0.12
IGL02322:Xirp2	APN	2	67508738	missense	probably benign	0.00
IGL02327:Xirp2	APN	2	67510100	missense	probably damaging	1.00
IGL02378:Xirp2	APN	2	67513768	missense	probably benign	0.00
IGL02492:Xirp2	APN	2	67516167	missense	probably damaging	0.99
IGL02549:Xirp2	APN	2	67513102	missense	probably benign	0.03
IGL02578:Xirp2	APN	2	67511247	missense	probably damaging	0.96
IGL02635:Xirp2	APN	2	67507910	missense	possibly damaging	0.86
IGL02654:Xirp2	APN	2	67514671	missense	possibly damaging	0.86
IGL02663:Xirp2	APN	2	67509458	missense	possibly damaging	0.92
IGL02795:Xirp2	APN	2	67509136	missense	probably damaging	1.00
IGL02934:Xirp2	APN	2	67515676	missense	probably benign	0.33
IGL03003:Xirp2	APN	2	67515562	missense	possibly damaging	0.93
IGL03069:Xirp2	APN	2	67509532	missense	possibly damaging	0.91
IGL03286:Xirp2	APN	2	67516310	missense	probably damaging	0.99
IGL03326:Xirp2	APN	2	67482246	missense	probably benign	0.01
IGL03381:Xirp2	APN	2	67514226	missense	probably benign	0.34
IGL03394:Xirp2	APN	2	67515194	missense	probably damaging	0.99
3-1:Xirp2	UTSW	2	67508198	missense	possibly damaging	0.95
H8562:Xirp2	UTSW	2	67515457	missense	probably benign
PIT4142001:Xirp2	UTSW	2	67519362	splice site	probably benign
PIT4260001:Xirp2	UTSW	2	67511597	missense	possibly damaging	0.96
PIT4445001:Xirp2	UTSW	2	67509772	missense	possibly damaging	0.84
PIT4531001:Xirp2	UTSW	2	67515482	missense	possibly damaging	0.73
R0015:Xirp2	UTSW	2	67510899	nonsense	probably null
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0063:Xirp2	UTSW	2	67509083	missense	probably damaging	0.99
R0066:Xirp2	UTSW	2	67512140	missense	possibly damaging	0.85
R0109:Xirp2	UTSW	2	67519278	missense	probably damaging	1.00
R0111:Xirp2	UTSW	2	67508378	missense	probably damaging	0.99
R0115:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0117:Xirp2	UTSW	2	67517120	missense	possibly damaging	0.94
R0133:Xirp2	UTSW	2	67517124	missense	probably benign
R0282:Xirp2	UTSW	2	67513380	missense	probably damaging	0.96
R0463:Xirp2	UTSW	2	67514918	missense	probably benign	0.02
R0481:Xirp2	UTSW	2	67509909	missense	possibly damaging	0.92
R0488:Xirp2	UTSW	2	67514821	missense	possibly damaging	0.90
R0548:Xirp2	UTSW	2	67514414	missense	probably benign	0.00
R0582:Xirp2	UTSW	2	67508866	missense	probably benign
R0723:Xirp2	UTSW	2	67512215	missense	probably damaging	0.98
R0835:Xirp2	UTSW	2	67507910	missense	possibly damaging	0.86
R1160:Xirp2	UTSW	2	67509887	missense	possibly damaging	0.92
R1189:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R1474:Xirp2	UTSW	2	67525067	missense	probably benign	0.00
R1513:Xirp2	UTSW	2	67511530	missense	probably benign	0.00
R1514:Xirp2	UTSW	2	67514323	nonsense	probably null
R1519:Xirp2	UTSW	2	67515679	missense	probably benign	0.44
R1532:Xirp2	UTSW	2	67513939	missense	probably benign	0.00
R1537:Xirp2	UTSW	2	67510013	missense	probably damaging	0.98
R1541:Xirp2	UTSW	2	67512290	missense	possibly damaging	0.70
R1543:Xirp2	UTSW	2	67508039	missense	probably benign
R1607:Xirp2	UTSW	2	67510295	nonsense	probably null
R1620:Xirp2	UTSW	2	67510835	missense	probably damaging	0.98
R1709:Xirp2	UTSW	2	67509871	missense	probably benign	0.33
R1713:Xirp2	UTSW	2	67512418	missense	probably benign	0.25
R1828:Xirp2	UTSW	2	67515238	missense	possibly damaging	0.86
R1834:Xirp2	UTSW	2	67511140	missense	probably damaging	0.99
R1905:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1907:Xirp2	UTSW	2	67516356	missense	probably damaging	0.98
R1943:Xirp2	UTSW	2	67512615	missense	probably benign	0.34
R1971:Xirp2	UTSW	2	67511695	missense	possibly damaging	0.48
R1998:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R2075:Xirp2	UTSW	2	67510201	missense	probably benign	0.33
R2132:Xirp2	UTSW	2	67508048	missense	possibly damaging	0.72
R2175:Xirp2	UTSW	2	67509914	missense	probably damaging	0.99
R2310:Xirp2	UTSW	2	67526247	missense	probably benign	0.19
R2338:Xirp2	UTSW	2	67510770	missense	probably damaging	0.98
R2426:Xirp2	UTSW	2	67514471	missense	probably benign	0.02
R2483:Xirp2	UTSW	2	67524992	missense	probably benign
R3084:Xirp2	UTSW	2	67509049	missense	probably damaging	0.97
R3113:Xirp2	UTSW	2	67510147	missense	probably benign	0.33
R3903:Xirp2	UTSW	2	67508036	missense	probably benign	0.40
R3916:Xirp2	UTSW	2	67511422	missense	probably benign	0.25
R3928:Xirp2	UTSW	2	67511669	missense	possibly damaging	0.85
R4025:Xirp2	UTSW	2	67511402	missense	probably benign	0.12
R4135:Xirp2	UTSW	2	67525397	missense	probably benign	0.00
R4223:Xirp2	UTSW	2	67516493	missense	possibly damaging	0.66
R4257:Xirp2	UTSW	2	67516039	missense	probably benign	0.31
R4499:Xirp2	UTSW	2	67513438	missense	probably benign	0.08
R4577:Xirp2	UTSW	2	67513897	missense	probably damaging	0.99
R4739:Xirp2	UTSW	2	67519265	missense	probably damaging	0.99
R4758:Xirp2	UTSW	2	67516535	missense	probably damaging	0.98
R4834:Xirp2	UTSW	2	67516406	missense	probably benign	0.26
R4855:Xirp2	UTSW	2	67511064	missense	possibly damaging	0.96
R4923:Xirp2	UTSW	2	67512893	missense	probably benign
R4936:Xirp2	UTSW	2	67509819	missense	possibly damaging	0.85
R5032:Xirp2	UTSW	2	67525670	missense	possibly damaging	0.84
R5049:Xirp2	UTSW	2	67517134	missense	probably benign	0.03
R5077:Xirp2	UTSW	2	67514477	missense	probably benign
R5090:Xirp2	UTSW	2	67525470	missense	possibly damaging	0.83
R5107:Xirp2	UTSW	2	67509710	missense	probably damaging	0.99
R5107:Xirp2	UTSW	2	67511861	missense	probably damaging	1.00
R5187:Xirp2	UTSW	2	67515367	missense	probably benign	0.01
R5241:Xirp2	UTSW	2	67482360	nonsense	probably null
R5307:Xirp2	UTSW	2	67511162	missense	probably damaging	0.99
R5342:Xirp2	UTSW	2	67513461	missense	probably damaging	0.96
R5370:Xirp2	UTSW	2	67512152	missense	possibly damaging	0.72
R5375:Xirp2	UTSW	2	67511906	missense	probably damaging	0.99
R5407:Xirp2	UTSW	2	67510969	missense	probably benign	0.33
R5514:Xirp2	UTSW	2	67505121	missense	probably benign	0.03
R5531:Xirp2	UTSW	2	67515302	missense	probably benign	0.42
R5590:Xirp2	UTSW	2	67514035	missense	probably benign	0.23
R5646:Xirp2	UTSW	2	67510790	missense	probably damaging	0.99
R5649:Xirp2	UTSW	2	67516895	missense	probably benign	0.00
R5686:Xirp2	UTSW	2	67482298	missense	probably damaging	0.99
R5761:Xirp2	UTSW	2	67510967	missense	probably benign	0.00
R5777:Xirp2	UTSW	2	67510004	missense	possibly damaging	0.92
R5785:Xirp2	UTSW	2	67509662	missense	probably damaging	0.96
R5843:Xirp2	UTSW	2	67476785	start gained	probably benign
R5846:Xirp2	UTSW	2	67509243	missense	probably damaging	0.98
R5875:Xirp2	UTSW	2	67505080	missense	probably benign	0.00
R5896:Xirp2	UTSW	2	67508698	missense	probably benign	0.32
R5896:Xirp2	UTSW	2	67509946	missense	possibly damaging	0.91
R5901:Xirp2	UTSW	2	67513066	missense	possibly damaging	0.91
R5934:Xirp2	UTSW	2	67524804	missense	possibly damaging	0.92
R5950:Xirp2	UTSW	2	67511320	missense	possibly damaging	0.95
R5996:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6013:Xirp2	UTSW	2	67510943	missense	possibly damaging	0.48
R6048:Xirp2	UTSW	2	67508243	missense	possibly damaging	0.96
R6111:Xirp2	UTSW	2	67511817	missense	possibly damaging	0.86
R6180:Xirp2	UTSW	2	67505577	critical splice donor site	probably null
R6342:Xirp2	UTSW	2	67511650	missense	possibly damaging	0.91
R6346:Xirp2	UTSW	2	67516081	missense	probably benign	0.00
R6603:Xirp2	UTSW	2	67516544	missense	probably benign
R6604:Xirp2	UTSW	2	67509845	missense	possibly damaging	0.86
R6669:Xirp2	UTSW	2	67513355	missense	possibly damaging	0.78
R6701:Xirp2	UTSW	2	67516225	missense	possibly damaging	0.94
R6726:Xirp2	UTSW	2	67512868	missense	possibly damaging	0.88
R6833:Xirp2	UTSW	2	67509950	missense	probably benign	0.12
R6897:Xirp2	UTSW	2	67508567	missense	probably damaging	1.00
R6933:Xirp2	UTSW	2	67514857	missense	probably benign	0.34
R7020:Xirp2	UTSW	2	67525569	missense	probably benign
R7042:Xirp2	UTSW	2	67513289	missense	probably benign	0.12
R7060:Xirp2	UTSW	2	67515608	missense	probably damaging	1.00
R7179:Xirp2	UTSW	2	67509833	missense	probably benign	0.00
R7229:Xirp2	UTSW	2	67525551	missense	probably damaging	0.99
R7253:Xirp2	UTSW	2	67513482	missense	probably benign
R7284:Xirp2	UTSW	2	67516829	missense	probably benign
R7450:Xirp2	UTSW	2	67509815	missense	possibly damaging	0.86
R7476:Xirp2	UTSW	2	67510634	missense	probably benign	0.01
R7489:Xirp2	UTSW	2	67525560	missense	possibly damaging	0.83
R7513:Xirp2	UTSW	2	67510764	missense	possibly damaging	0.86
R7549:Xirp2	UTSW	2	67508897	missense	possibly damaging	0.91
R7563:Xirp2	UTSW	2	67509901	missense	probably damaging	0.99
R7567:Xirp2	UTSW	2	67515982	missense	probably benign	0.02
R7577:Xirp2	UTSW	2	67514965	missense	possibly damaging	0.65
R7597:Xirp2	UTSW	2	67525755	missense	possibly damaging	0.84
R7610:Xirp2	UTSW	2	67525962	missense	possibly damaging	0.92
R7613:Xirp2	UTSW	2	67514498	missense	probably benign	0.00
R7669:Xirp2	UTSW	2	67512177	missense	probably benign	0.00
R7670:Xirp2	UTSW	2	67510573	missense	possibly damaging	0.91
R7673:Xirp2	UTSW	2	67517087	missense	probably damaging	1.00
R7682:Xirp2	UTSW	2	67508849	missense	probably damaging	0.99
X0063:Xirp2	UTSW	2	67516123	missense	probably benign	0.04
X0065:Xirp2	UTSW	2	67515118	missense	probably benign	0.34
Z1088:Xirp2	UTSW	2	67513321	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AACCGTTGTATTGAACCTCCACCC -3'
(R):5'- CGACTGCATCGTAGCTTTCAGTCTC -3'

Sequencing Primer
(F):5'- GGAGTCGTTCAGAACAACTTGTC -3'
(R):5'- AGCTTTCAGTCTCTGGCATTG -3'

Posted On

2013-06-11