Incidental Mutation 'R0557:Ano3'
ID 45602
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 038749-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0557 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 110862952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623] [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably null
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense not run
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCGTAGAGCTGAATGCTCAAATGT -3'
(R):5'- ACGTCTGATCCACCTGAAGGCAA -3'

Sequencing Primer
(F):5'- CAGCTTTGTCTTGGATGCAG -3'
(R):5'- TCCACCTGAAGGCAACATTATGAG -3'
Posted On 2013-06-11