Incidental Mutation 'R5885:Spats2l'
ID456020
Institutional Source Beutler Lab
Gene Symbol Spats2l
Ensembl Gene ENSMUSG00000038305
Gene Namespermatogenesis associated, serine-rich 2-like
SynonymsA230104H11Rik, 2810022L02Rik
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location57774162-57948394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57946162 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 458 (A458V)
Ref Sequence ENSEMBL: ENSMUSP00000127598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163239] [ENSMUST00000164302] [ENSMUST00000167085] [ENSMUST00000169772] [ENSMUST00000170139]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163239
AA Change: A351V

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128992
Gene: ENSMUSG00000038305
AA Change: A351V

DomainStartEndE-ValueType
Pfam:DUF1387 1 261 9.7e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164302
AA Change: A389V

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132592
Gene: ENSMUSG00000038305
AA Change: A389V

DomainStartEndE-ValueType
Pfam:DUF1387 59 149 3.6e-25 PFAM
Pfam:DUF1387 146 299 1.6e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167085
AA Change: A479V

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133054
Gene: ENSMUSG00000038305
AA Change: A479V

DomainStartEndE-ValueType
Pfam:DUF1387 79 388 1.8e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169772
AA Change: A458V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132975
Gene: ENSMUSG00000038305
AA Change: A458V

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170139
AA Change: A458V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127598
Gene: ENSMUSG00000038305
AA Change: A458V

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Spats2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spats2l APN 1 57943072 missense probably damaging 1.00
IGL00788:Spats2l APN 1 57885705 missense probably damaging 1.00
IGL01627:Spats2l APN 1 57902082 splice site probably benign
IGL01758:Spats2l APN 1 57879556 missense probably damaging 1.00
IGL03395:Spats2l APN 1 57938016 missense probably damaging 1.00
P0033:Spats2l UTSW 1 57885838 missense probably damaging 0.99
R0762:Spats2l UTSW 1 57885884 missense possibly damaging 0.88
R1167:Spats2l UTSW 1 57943111 missense probably damaging 1.00
R1486:Spats2l UTSW 1 57900811 missense probably damaging 0.99
R1564:Spats2l UTSW 1 57946224 missense probably damaging 1.00
R1938:Spats2l UTSW 1 57885782 missense probably benign 0.32
R2071:Spats2l UTSW 1 57940464 missense possibly damaging 0.90
R2096:Spats2l UTSW 1 57946299 missense probably benign 0.00
R2215:Spats2l UTSW 1 57946416 missense possibly damaging 0.82
R3053:Spats2l UTSW 1 57900766 missense probably damaging 1.00
R3784:Spats2l UTSW 1 57885779 missense probably damaging 0.99
R4814:Spats2l UTSW 1 57937926 missense possibly damaging 0.83
R4915:Spats2l UTSW 1 57902188 missense probably damaging 1.00
R4962:Spats2l UTSW 1 57885824 missense possibly damaging 0.88
R5022:Spats2l UTSW 1 57879556 missense probably damaging 1.00
R5068:Spats2l UTSW 1 57943221 missense probably benign
R5561:Spats2l UTSW 1 57900621 splice site probably null
R5773:Spats2l UTSW 1 57879549 missense possibly damaging 0.86
R6136:Spats2l UTSW 1 57902143 missense probably damaging 1.00
R6651:Spats2l UTSW 1 57946177 missense probably damaging 1.00
R6929:Spats2l UTSW 1 57879536 missense probably damaging 1.00
R7030:Spats2l UTSW 1 57879530 missense probably damaging 1.00
R7176:Spats2l UTSW 1 57937918 missense possibly damaging 0.89
R7274:Spats2l UTSW 1 57879513 nonsense probably null
R7342:Spats2l UTSW 1 57885947 missense possibly damaging 0.91
R7387:Spats2l UTSW 1 57902134 missense probably damaging 1.00
R7459:Spats2l UTSW 1 57799353 splice site probably benign
X0054:Spats2l UTSW 1 57943243 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGACAGATTTTCCTGATGC -3'
(R):5'- AAAGATTGCACTGTGAAACCCTAC -3'

Sequencing Primer
(F):5'- GGACAGATTTTCCTGATGCCTACTAG -3'
(R):5'- GCCTCTAAGTTGTCTGCAGCATG -3'
Posted On2017-02-15