Incidental Mutation 'R5885:Lrrc47'
ID456031
Institutional Source Beutler Lab
Gene Symbol Lrrc47
Ensembl Gene ENSMUSG00000029028
Gene Nameleucine rich repeat containing 47
Synonyms
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5885 (G1)
Quality Score160
Status Not validated
Chromosome4
Chromosomal Location154011731-154021513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154015972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 335 (V335D)
Ref Sequence ENSEMBL: ENSMUSP00000133124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030894] [ENSMUST00000143047] [ENSMUST00000169622] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030894
AA Change: V313D

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030894
Gene: ENSMUSG00000029028
AA Change: V313D

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 10 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
LRR_TYP 100 123 2.61e-4 SMART
LRR_TYP 130 153 2.12e-4 SMART
LRR 155 177 3.75e0 SMART
LRR 180 202 9.77e1 SMART
LRR_TYP 203 226 2.27e-4 SMART
low complexity region 261 272 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
B3_4 331 507 8.94e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142794
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163672
Predicted Effect probably benign
Transcript: ENSMUST00000167947
SMART Domains Protein: ENSMUSP00000131382
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
Pfam:B3_4 1 54 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169622
AA Change: V335D

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133124
Gene: ENSMUSG00000029028
AA Change: V335D

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
low complexity region 32 58 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
LRR_TYP 122 145 2.61e-4 SMART
LRR_TYP 152 175 2.12e-4 SMART
LRR 177 199 3.75e0 SMART
LRR 202 224 9.77e1 SMART
LRR_TYP 225 248 2.27e-4 SMART
low complexity region 283 294 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
B3_4 353 529 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Lrrc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc47 APN 4 154016014 missense probably benign 0.01
IGL02614:Lrrc47 APN 4 154018935 splice site probably null
IGL03001:Lrrc47 APN 4 154015993 missense probably damaging 0.99
R0372:Lrrc47 UTSW 4 154019632 missense probably benign 0.00
R0433:Lrrc47 UTSW 4 154018365 unclassified probably benign
R0720:Lrrc47 UTSW 4 154019887 splice site probably null
R1163:Lrrc47 UTSW 4 154011817 start codon destroyed probably null
R2078:Lrrc47 UTSW 4 154019431 missense probably damaging 1.00
R2103:Lrrc47 UTSW 4 154015893 missense probably damaging 1.00
R5105:Lrrc47 UTSW 4 154012216 missense probably damaging 1.00
R5109:Lrrc47 UTSW 4 154017476 missense probably damaging 0.99
R5687:Lrrc47 UTSW 4 154015683 missense probably benign 0.10
R6198:Lrrc47 UTSW 4 154015672 missense probably damaging 1.00
R6384:Lrrc47 UTSW 4 154015860 missense probably benign 0.00
R7040:Lrrc47 UTSW 4 154020452 makesense probably null
R7680:Lrrc47 UTSW 4 154016101 missense probably benign 0.00
R8263:Lrrc47 UTSW 4 154016029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGAGTACCTTCGTGCTGG -3'
(R):5'- TGAATGCATGCCCACCCTAG -3'

Sequencing Primer
(F):5'- TACCTTCGTGCTGGTGGCC -3'
(R):5'- TAGCATGCACCCAAGTCTGTCTG -3'
Posted On2017-02-15