Incidental Mutation 'R5885:Slc2a9'
ID456032
Institutional Source Beutler Lab
Gene Symbol Slc2a9
Ensembl Gene ENSMUSG00000005107
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 9
SynonymsSLC2a9A, Glut9, SLC2A9B
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38349273-38503143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38440674 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 137 (R137W)
Ref Sequence ENSEMBL: ENSMUSP00000116354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005238] [ENSMUST00000067872] [ENSMUST00000067886] [ENSMUST00000122970] [ENSMUST00000129099] [ENSMUST00000143758] [ENSMUST00000147664] [ENSMUST00000155634] [ENSMUST00000156272]
Predicted Effect probably benign
Transcript: ENSMUST00000005238
AA Change: R137W

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005238
Gene: ENSMUSG00000005107
AA Change: R137W

DomainStartEndE-ValueType
Pfam:MFS_1 20 208 3.5e-10 PFAM
Pfam:Sugar_tr 25 188 1.1e-35 PFAM
Pfam:Sugar_tr 191 373 5.3e-39 PFAM
Pfam:MFS_1 196 397 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067872
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066872
Gene: ENSMUSG00000005107
AA Change: R137W

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067886
AA Change: R152W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063352
Gene: ENSMUSG00000005107
AA Change: R152W

DomainStartEndE-ValueType
Pfam:MFS_1 37 344 1.7e-16 PFAM
Pfam:Sugar_tr 40 495 9.8e-107 PFAM
Pfam:MFS_1 328 518 1.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122970
AA Change: R152W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117390
Gene: ENSMUSG00000005107
AA Change: R152W

DomainStartEndE-ValueType
Pfam:MFS_1 28 269 7.5e-14 PFAM
Pfam:Sugar_tr 40 260 2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129099
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122723
Gene: ENSMUSG00000005107
AA Change: R137W

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143758
AA Change: R152W

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118430
Gene: ENSMUSG00000005107
AA Change: R152W

DomainStartEndE-ValueType
Pfam:MFS_1 37 223 4.2e-10 PFAM
Pfam:Sugar_tr 40 203 1.2e-35 PFAM
Pfam:Sugar_tr 206 388 5.8e-39 PFAM
Pfam:MFS_1 209 411 2.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144290
Predicted Effect probably damaging
Transcript: ENSMUST00000147664
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119586
Gene: ENSMUSG00000005107
AA Change: R137W

DomainStartEndE-ValueType
Pfam:Sugar_tr 25 143 9.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155634
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116354
Gene: ENSMUSG00000005107
AA Change: R137W

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156272
SMART Domains Protein: ENSMUSP00000144374
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:Sugar_tr 40 111 4.5e-9 PFAM
transmembrane domain 140 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial prenatal lethality, polydipsia, hyperuricemia, hyperuricosuria and polyuria, and develop urate nephropathy, characterized by obstructive lithiasis, tubulointerstitial inflammation, cortical fibrosis, renal insufficiency and reduced male weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Slc2a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Slc2a9 APN 5 38436670 missense probably benign 0.19
IGL02505:Slc2a9 APN 5 38436659 missense possibly damaging 0.69
IGL03096:Slc2a9 APN 5 38351229 missense probably damaging 1.00
transporter9 UTSW 5 38382044 missense probably damaging 1.00
R0121:Slc2a9 UTSW 5 38398743 missense probably benign 0.00
R0395:Slc2a9 UTSW 5 38453169 missense probably damaging 1.00
R0599:Slc2a9 UTSW 5 38480144 start gained probably benign
R0610:Slc2a9 UTSW 5 38379942 missense probably damaging 1.00
R0993:Slc2a9 UTSW 5 38382063 missense probably damaging 1.00
R1166:Slc2a9 UTSW 5 38382041 critical splice donor site probably null
R1710:Slc2a9 UTSW 5 38382044 missense probably damaging 1.00
R2256:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R2257:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R4066:Slc2a9 UTSW 5 38483349 missense probably benign 0.03
R4193:Slc2a9 UTSW 5 38398706 missense probably damaging 1.00
R4502:Slc2a9 UTSW 5 38398811 missense probably benign 0.04
R4734:Slc2a9 UTSW 5 38382099 missense probably damaging 1.00
R4917:Slc2a9 UTSW 5 38417260 missense probably benign 0.01
R5218:Slc2a9 UTSW 5 38453181 missense probably damaging 1.00
R6313:Slc2a9 UTSW 5 38453121 missense probably benign 0.03
R6983:Slc2a9 UTSW 5 38391721 missense probably damaging 1.00
R7173:Slc2a9 UTSW 5 38452871 splice site probably null
R7286:Slc2a9 UTSW 5 38453195 missense probably damaging 0.99
R7405:Slc2a9 UTSW 5 38391824 missense probably damaging 1.00
R7573:Slc2a9 UTSW 5 38417226 missense probably damaging 1.00
R7594:Slc2a9 UTSW 5 38351291 missense probably benign 0.00
R8212:Slc2a9 UTSW 5 38480059 missense probably benign 0.00
R8508:Slc2a9 UTSW 5 38382078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGACTCAGCTCTACCAAGC -3'
(R):5'- CTGTTTGCGGGAGAAAGGAC -3'

Sequencing Primer
(F):5'- CTCAGGTTGGTTACTAGAACACTG -3'
(R):5'- GGAGAAAGGACACTGTCACACTTC -3'
Posted On2017-02-15