Incidental Mutation 'R5885:Flt3'
ID456035
Institutional Source Beutler Lab
Gene Symbol Flt3
Ensembl Gene ENSMUSG00000042817
Gene NameFMS-like tyrosine kinase 3
SynonymsFlt-3, CD135, Flk-2, wmfl, Flk2
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147330741-147400489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147349629 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 716 (T716A)
Ref Sequence ENSEMBL: ENSMUSP00000039041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049324]
Predicted Effect probably damaging
Transcript: ENSMUST00000049324
AA Change: T716A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817
AA Change: T716A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
internal_repeat_1 380 529 8.53e-14 PROSPERO
TyrKc 611 946 1.7e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Flt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Flt3 APN 5 147354876 missense probably damaging 1.00
IGL01083:Flt3 APN 5 147354870 missense probably damaging 1.00
IGL01749:Flt3 APN 5 147358028 missense probably benign 0.02
IGL01765:Flt3 APN 5 147357978 missense probably benign
IGL02109:Flt3 APN 5 147350681 missense probably benign 0.00
IGL02490:Flt3 APN 5 147331296 missense probably damaging 1.00
IGL02631:Flt3 APN 5 147344552 missense probably damaging 1.00
IGL03117:Flt3 APN 5 147356210 missense probably benign
flick UTSW 5 147341238 missense probably damaging 1.00
warmflash UTSW 5 147366918 critical splice donor site probably null
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0320:Flt3 UTSW 5 147369579 splice site probably benign
R0347:Flt3 UTSW 5 147357992 missense probably damaging 1.00
R0512:Flt3 UTSW 5 147341270 nonsense probably null
R0968:Flt3 UTSW 5 147341227 missense possibly damaging 0.46
R1180:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R1266:Flt3 UTSW 5 147356860 missense probably benign 0.00
R1562:Flt3 UTSW 5 147344513 missense probably damaging 1.00
R1803:Flt3 UTSW 5 147367055 nonsense probably null
R2000:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R2021:Flt3 UTSW 5 147369490 missense probably damaging 0.98
R2079:Flt3 UTSW 5 147355083 missense probably damaging 0.97
R2261:Flt3 UTSW 5 147348063 missense probably benign 0.00
R2263:Flt3 UTSW 5 147348063 missense probably benign 0.00
R3087:Flt3 UTSW 5 147348046 missense probably benign 0.15
R3727:Flt3 UTSW 5 147354923 missense probably damaging 0.96
R3939:Flt3 UTSW 5 147356243 missense possibly damaging 0.87
R4469:Flt3 UTSW 5 147375644 splice site silent
R4527:Flt3 UTSW 5 147356353 missense probably benign 0.37
R4592:Flt3 UTSW 5 147354699 missense possibly damaging 0.67
R4655:Flt3 UTSW 5 147349593 missense possibly damaging 0.51
R4686:Flt3 UTSW 5 147377048 missense probably damaging 1.00
R4867:Flt3 UTSW 5 147334440 missense probably damaging 1.00
R4897:Flt3 UTSW 5 147369300 missense probably damaging 1.00
R4941:Flt3 UTSW 5 147356375 critical splice acceptor site probably null
R5254:Flt3 UTSW 5 147375690 missense possibly damaging 0.60
R5325:Flt3 UTSW 5 147375649 missense probably benign 0.00
R5395:Flt3 UTSW 5 147354823 missense probably damaging 1.00
R5445:Flt3 UTSW 5 147355095 nonsense probably null
R5469:Flt3 UTSW 5 147355083 missense possibly damaging 0.63
R5556:Flt3 UTSW 5 147332997 splice site probably null
R5660:Flt3 UTSW 5 147369481 missense possibly damaging 0.79
R5879:Flt3 UTSW 5 147334909 missense probably damaging 1.00
R6554:Flt3 UTSW 5 147375735 missense probably damaging 0.99
R6813:Flt3 UTSW 5 147354843 missense probably damaging 0.97
R7451:Flt3 UTSW 5 147349667 missense probably damaging 1.00
R7469:Flt3 UTSW 5 147331274 missense probably benign 0.18
R7537:Flt3 UTSW 5 147334437 missense probably damaging 1.00
R7605:Flt3 UTSW 5 147349576 missense probably benign 0.01
R7651:Flt3 UTSW 5 147354922 missense probably damaging 1.00
R7842:Flt3 UTSW 5 147334453 missense probably damaging 1.00
R8051:Flt3 UTSW 5 147358955 intron probably benign
R8236:Flt3 UTSW 5 147356860 missense probably benign 0.00
R8305:Flt3 UTSW 5 147348054 missense probably damaging 0.96
R8337:Flt3 UTSW 5 147332888 critical splice donor site probably null
R8680:Flt3 UTSW 5 147383455 missense probably benign 0.13
R8682:Flt3 UTSW 5 147383455 missense probably benign 0.13
R8697:Flt3 UTSW 5 147358001 missense possibly damaging 0.94
R8824:Flt3 UTSW 5 147334863 missense probably damaging 1.00
R8959:Flt3 UTSW 5 147366964 missense possibly damaging 0.93
X0018:Flt3 UTSW 5 147367066 missense possibly damaging 0.54
Z1088:Flt3 UTSW 5 147349564 critical splice donor site probably null
Z1177:Flt3 UTSW 5 147383401 missense probably benign 0.27
Z31818:Flt3 UTSW 5 147366918 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGCTGCCTTAGGTCTCAGG -3'
(R):5'- GTGTGATTTTGGAGGAAAGACC -3'

Sequencing Primer
(F):5'- CTTAGGTCTCAGGCCACAC -3'
(R):5'- AGACCTGACCTGTGTCTAAACCTG -3'
Posted On2017-02-15