Incidental Mutation 'R5885:Tas2r121'
ID456036
Institutional Source Beutler Lab
Gene Symbol Tas2r121
Ensembl Gene ENSMUSG00000071150
Gene Nametaste receptor, type 2, member 121
SynonymsTas2r21, T2R21, mGR21, mT2r48
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132700090-132701007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132700291 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 239 (L239F)
Ref Sequence ENSEMBL: ENSMUSP00000093044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095395]
Predicted Effect probably damaging
Transcript: ENSMUST00000095395
AA Change: L239F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093044
Gene: ENSMUSG00000071150
AA Change: L239F

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 4.5e-108 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Tas2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Tas2r121 APN 6 132700521 missense probably benign 0.28
IGL01868:Tas2r121 APN 6 132700272 missense probably benign 0.00
IGL02182:Tas2r121 APN 6 132700170 missense probably damaging 0.99
IGL02728:Tas2r121 APN 6 132700517 missense probably damaging 1.00
R0833:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R0836:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R1181:Tas2r121 UTSW 6 132700169 missense probably damaging 1.00
R1424:Tas2r121 UTSW 6 132700682 missense probably damaging 1.00
R1583:Tas2r121 UTSW 6 132700230 nonsense probably null
R2179:Tas2r121 UTSW 6 132700868 missense probably damaging 1.00
R4711:Tas2r121 UTSW 6 132700890 missense probably benign 0.28
R5274:Tas2r121 UTSW 6 132700848 missense probably damaging 1.00
R5308:Tas2r121 UTSW 6 132700517 missense possibly damaging 0.84
R5663:Tas2r121 UTSW 6 132700557 missense probably benign 0.10
R5668:Tas2r121 UTSW 6 132700793 missense possibly damaging 0.95
R6395:Tas2r121 UTSW 6 132700532 missense probably benign 0.23
R7552:Tas2r121 UTSW 6 132700542 missense probably benign 0.17
R8094:Tas2r121 UTSW 6 132700809 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCACCCAAAGACTGGCTTGC -3'
(R):5'- TAACTTGGAGTTCTAGAGTGAGTGAC -3'

Sequencing Primer
(F):5'- GGCTTGCCTTAAATTAGAATGTCCC -3'
(R):5'- AGTGACTTTGCAGGGTTTTCAAATC -3'
Posted On2017-02-15