Incidental Mutation 'R5885:Psg22'
ID456038
Institutional Source Beutler Lab
Gene Symbol Psg22
Ensembl Gene ENSMUSG00000044903
Gene Namepregnancy-specific glycoprotein 22
Synonymscea9
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18718090-18727248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18718332 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 19 (L19Q)
Ref Sequence ENSEMBL: ENSMUSP00000146795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051973] [ENSMUST00000108481] [ENSMUST00000208221]
Predicted Effect probably damaging
Transcript: ENSMUST00000051973
AA Change: L19Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050633
Gene: ENSMUSG00000044903
AA Change: L19Q

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 141 7.59e-4 SMART
IG 160 261 1.13e-2 SMART
IG 280 381 3.74e-3 SMART
IGc2 397 461 7.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108481
AA Change: L58Q

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104121
Gene: ENSMUSG00000044903
AA Change: L58Q

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
IG 79 180 7.59e-4 SMART
IG 199 300 1.13e-2 SMART
IG 319 420 3.74e-3 SMART
IGc2 436 500 7.35e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207958
Predicted Effect probably damaging
Transcript: ENSMUST00000208221
AA Change: L19Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Psg22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Psg22 APN 7 18718275 missense probably benign 0.00
IGL00839:Psg22 APN 7 18722968 missense probably benign 0.01
IGL00898:Psg22 APN 7 18724467 missense probably damaging 1.00
IGL02262:Psg22 APN 7 18724571 missense probably damaging 0.98
IGL02678:Psg22 APN 7 18719493 missense probably damaging 0.99
IGL02749:Psg22 APN 7 18723019 missense possibly damaging 0.50
IGL02928:Psg22 APN 7 18719533 missense probably damaging 0.98
IGL02977:Psg22 APN 7 18719599 missense probably benign 0.20
R0470:Psg22 UTSW 7 18719664 missense probably damaging 0.99
R1902:Psg22 UTSW 7 18724438 nonsense probably null
R1935:Psg22 UTSW 7 18719710 missense probably damaging 0.99
R1936:Psg22 UTSW 7 18719710 missense probably damaging 0.99
R2013:Psg22 UTSW 7 18719635 missense possibly damaging 0.93
R2278:Psg22 UTSW 7 18726837 missense possibly damaging 0.80
R4258:Psg22 UTSW 7 18724629 missense probably damaging 1.00
R5029:Psg22 UTSW 7 18719737 missense probably damaging 1.00
R6084:Psg22 UTSW 7 18719780 missense probably benign 0.01
R6143:Psg22 UTSW 7 18722798 missense probably benign 0.03
R6209:Psg22 UTSW 7 18719674 missense probably damaging 1.00
R7017:Psg22 UTSW 7 18724441 missense probably benign 0.01
R7337:Psg22 UTSW 7 18719574 missense probably benign 0.20
R7417:Psg22 UTSW 7 18722966 missense probably damaging 1.00
R7460:Psg22 UTSW 7 18724404 missense probably benign 0.03
R7570:Psg22 UTSW 7 18722735 missense possibly damaging 0.95
R7650:Psg22 UTSW 7 18726759 missense possibly damaging 0.66
R7711:Psg22 UTSW 7 18718342 critical splice donor site probably null
R7991:Psg22 UTSW 7 18726936 missense probably damaging 1.00
R8001:Psg22 UTSW 7 18719746 missense possibly damaging 0.79
R8003:Psg22 UTSW 7 18724425 missense probably damaging 1.00
R8066:Psg22 UTSW 7 18718293 missense possibly damaging 0.88
R8113:Psg22 UTSW 7 18723062 missense probably benign 0.00
X0064:Psg22 UTSW 7 18718181 missense probably benign 0.01
Z1177:Psg22 UTSW 7 18719677 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTGACTGAGCAGTGTCGTG -3'
(R):5'- TGGTCAGAGATTCCTGCTGC -3'

Sequencing Primer
(F):5'- CAGCCCATAGGATTCTGGGATG -3'
(R):5'- TCAGAGATTCCTGCTGCTGAGC -3'
Posted On2017-02-15