Incidental Mutation 'R5885:Axl'
ID456039
Institutional Source Beutler Lab
Gene Symbol Axl
Ensembl Gene ENSMUSG00000002602
Gene NameAXL receptor tyrosine kinase
SynonymsTyro7, Ufo, Ark
MMRRC Submission 043237-MU
Accession Numbers

Genbank: NM_009465; MGI: 1347244

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25757273-25788705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25766852 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 510 (K510I)
Ref Sequence ENSEMBL: ENSMUSP00000083110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]
Predicted Effect probably damaging
Transcript: ENSMUST00000002677
AA Change: K519I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: K519I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085948
AA Change: K510I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: K510I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124442
Predicted Effect unknown
Transcript: ENSMUST00000132038
AA Change: K142I
SMART Domains Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602
AA Change: K142I

DomainStartEndE-ValueType
Blast:FN3 2 42 8e-20 BLAST
SCOP:d1gh7a2 2 61 4e-7 SMART
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Pkinase_Tyr 154 188 4.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Axl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Axl APN 7 25785899 missense probably benign 0.16
IGL00428:Axl APN 7 25760872 missense probably damaging 1.00
IGL00725:Axl APN 7 25764483 missense probably damaging 0.97
IGL01348:Axl APN 7 25763309 missense probably damaging 1.00
IGL01350:Axl APN 7 25758750 missense probably damaging 1.00
IGL01357:Axl APN 7 25774169 missense probably benign 0.00
IGL02314:Axl APN 7 25786920 missense possibly damaging 0.50
IGL02321:Axl APN 7 25758769 missense probably damaging 1.00
IGL02839:Axl APN 7 25766791 critical splice donor site probably null
IGL02878:Axl APN 7 25758877 missense probably damaging 0.99
R0125:Axl UTSW 7 25786943 missense probably benign 0.00
R0529:Axl UTSW 7 25787287 splice site probably benign
R0539:Axl UTSW 7 25778717 unclassified probably benign
R0614:Axl UTSW 7 25774163 missense probably benign 0.18
R0747:Axl UTSW 7 25764059 missense possibly damaging 0.95
R1599:Axl UTSW 7 25763969 missense probably damaging 0.99
R1727:Axl UTSW 7 25760766 missense possibly damaging 0.68
R1880:Axl UTSW 7 25774548 missense probably damaging 1.00
R2206:Axl UTSW 7 25770636 missense probably damaging 1.00
R2513:Axl UTSW 7 25787516 missense probably benign
R2877:Axl UTSW 7 25766524 missense probably damaging 0.96
R3802:Axl UTSW 7 25788477 start codon destroyed probably null 0.98
R3915:Axl UTSW 7 25760744 splice site probably benign
R4064:Axl UTSW 7 25764020 missense probably benign 0.36
R4072:Axl UTSW 7 25763911 unclassified probably benign
R4073:Axl UTSW 7 25763911 unclassified probably benign
R4074:Axl UTSW 7 25763911 unclassified probably benign
R4378:Axl UTSW 7 25758837 missense probably benign 0.06
R5039:Axl UTSW 7 25785915 missense probably damaging 1.00
R5224:Axl UTSW 7 25786944 missense probably benign 0.00
R5328:Axl UTSW 7 25773411 missense probably damaging 1.00
R5519:Axl UTSW 7 25778662 missense possibly damaging 0.93
R6367:Axl UTSW 7 25787433 missense probably damaging 1.00
R6447:Axl UTSW 7 25770283 missense probably damaging 0.96
R6931:Axl UTSW 7 25761433 missense probably damaging 1.00
R7172:Axl UTSW 7 25786974 missense probably benign 0.33
R7355:Axl UTSW 7 25774106 missense probably benign 0.22
R7410:Axl UTSW 7 25758783 missense probably benign 0.06
R8274:Axl UTSW 7 25764013 missense probably damaging 0.99
R8279:Axl UTSW 7 25763954 missense probably benign 0.07
R8281:Axl UTSW 7 25763954 missense probably benign 0.07
R8282:Axl UTSW 7 25763954 missense probably benign 0.07
R8283:Axl UTSW 7 25763954 missense probably benign 0.07
R8546:Axl UTSW 7 25774163 missense probably benign 0.00
R8742:Axl UTSW 7 25764436 missense probably damaging 0.99
X0027:Axl UTSW 7 25770268 missense probably damaging 1.00
Z1177:Axl UTSW 7 25761526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGTTGGCTGAGAACTAG -3'
(R):5'- TGCTTCTATGGAGCCCATTG -3'

Sequencing Primer
(F):5'- AGAGAGGAATCTTGGCATTTTGG -3'
(R):5'- CCATTGGGAGGCTACAGGAAC -3'
Posted On2017-02-15