Incidental Mutation 'R0557:Ppm1l'
ID45604
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Nameprotein phosphatase 1 (formerly 2C)-like
Synonyms5930404J21Rik, Pp2ce, PP2C-epsilon
MMRRC Submission 038749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0557 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location69316861-69560802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69497901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 177 (D177G)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
Predicted Effect probably benign
Transcript: ENSMUST00000029355
AA Change: D177G

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: D177G

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193662
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chchd6 A G 6: 89,574,587 S31P probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69317950 missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69549343 missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69317976 splice site probably benign
R0310:Ppm1l UTSW 3 69549461 missense probably benign 0.39
R1577:Ppm1l UTSW 3 69553070 missense probably damaging 1.00
R3508:Ppm1l UTSW 3 69549480 missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69549328 missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69542511 intron probably benign
R5007:Ppm1l UTSW 3 69317598 missense probably damaging 1.00
R5406:Ppm1l UTSW 3 69317594 missense possibly damaging 0.66
R6168:Ppm1l UTSW 3 69549407 missense probably damaging 1.00
R6256:Ppm1l UTSW 3 69497897 missense probably benign
R6474:Ppm1l UTSW 3 69553041 missense probably damaging 0.99
R6517:Ppm1l UTSW 3 69317583 missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69549403 missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69553066 missense probably benign 0.16
R7086:Ppm1l UTSW 3 69317853 missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69317711 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTTGTGAGGCATGGACCACAC -3'
(R):5'- ACCACTGATAGAGCGTAGAGTCCTG -3'

Sequencing Primer
(F):5'- CTGGGTACTAACTCTGAGTACAC -3'
(R):5'- AGAGTCCTGTTTGTCCTTAATCAG -3'
Posted On2013-06-11