Incidental Mutation 'R5885:Atp10a'
ID 456040
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene Name ATPase, class V, type 10A
Synonyms Atp10c, pfatp
MMRRC Submission 043237-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5885 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 58656166-58829420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58813800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1027 (M1027K)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
AlphaFold O54827
Predicted Effect possibly damaging
Transcript: ENSMUST00000168747
AA Change: M1027K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: M1027K

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
R8166:Atp10a UTSW 7 58807522 missense possibly damaging 0.46
R8201:Atp10a UTSW 7 58819676 nonsense probably null
R8465:Atp10a UTSW 7 58828310 missense probably benign 0.32
R8858:Atp10a UTSW 7 58816223 missense probably damaging 1.00
R8985:Atp10a UTSW 7 58788344 missense probably benign 0.03
R9003:Atp10a UTSW 7 58807455 missense probably damaging 1.00
R9274:Atp10a UTSW 7 58828621 missense probably benign 0.22
R9385:Atp10a UTSW 7 58828139 missense probably benign 0.00
R9432:Atp10a UTSW 7 58819670 missense possibly damaging 0.95
R9454:Atp10a UTSW 7 58658591 missense probably benign
R9596:Atp10a UTSW 7 58827805 missense probably damaging 1.00
R9736:Atp10a UTSW 7 58824330 missense probably damaging 1.00
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAATCCAGAAACCCTAG -3'
(R):5'- ACAGGTGAACCGGCTTTTC -3'

Sequencing Primer
(F):5'- CTCTGAAAGCAACTTGAGTGTG -3'
(R):5'- GTGAACCGGCTTTTCTTACTTCATAG -3'
Posted On 2017-02-15