Mutagenetix > Incidental Mutation

Incidental Mutation 'R5885:Atp10a'

456040

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

043237-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R5885 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58813800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1027 (M1027K)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168747
AA Change: M1027K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: M1027K

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	A	T	13: 19,729,349		noncoding transcript	Het
Acot10	T	A	15: 20,666,104	M184L	probably benign	Het
Adgrv1	A	T	13: 81,424,271	S4924T	probably benign	Het
Axl	T	A	7: 25,766,852	K510I	probably damaging	Het
Azi2	T	A	9: 118,047,560	I48N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
Dnah3	T	C	7: 120,069,704	I720V	probably benign	Het
Dnah8	C	T	17: 30,794,717	P3811S	probably damaging	Het
Epas1	A	G	17: 86,827,544	D535G	probably damaging	Het
Fam47e	A	G	5: 92,565,968	K152R	probably damaging	Het
Fbxl3	A	T	14: 103,083,231	I260K	probably benign	Het
Fcgr3	A	G	1: 171,057,711	V115A	probably damaging	Het
Fgf12	G	T	16: 28,398,294	D98E	possibly damaging	Het
Flt3	T	C	5: 147,349,629	T716A	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Grin2a	A	G	16: 9,761,905	Y165H	possibly damaging	Het
Ifna4	T	A	4: 88,842,362	W168R	probably damaging	Het
Itga11	A	G	9: 62,762,850	Y752C	probably damaging	Het
Khdrbs3	A	G	15: 69,024,698		probably null	Het
Kif24	A	T	4: 41,423,463	Y263N	probably damaging	Het
Lama5	G	T	2: 180,201,831	T441K	probably damaging	Het
Lrrc47	T	A	4: 154,015,972	V335D	possibly damaging	Het
Map1b	A	T	13: 99,430,081	I2044N	unknown	Het
Mast2	C	T	4: 116,314,838	G638S	probably damaging	Het
Myo9a	T	C	9: 59,871,220	S1420P	probably benign	Het
Neurl2	T	C	2: 164,832,891	T184A	probably damaging	Het
Nfatc3	A	G	8: 106,096,312	I577V	probably benign	Het
Nipal3	A	T	4: 135,471,977	V186E	probably damaging	Het
Pgbd5	G	A	8: 124,384,466	T162M	probably damaging	Het
Plod2	T	A	9: 92,606,656		probably null	Het
Psg22	T	A	7: 18,718,332	L19Q	probably damaging	Het
Psg27	T	A	7: 18,561,786	N245Y	probably damaging	Het
Ptprc	T	A	1: 138,088,508	I539F	probably damaging	Het
Rad1	T	C	15: 10,488,057	L59P	probably damaging	Het
Slc2a9	G	A	5: 38,440,674	R137W	probably damaging	Het
Spats2l	C	T	1: 57,946,162	A458V	probably damaging	Het
Sptbn5	A	G	2: 120,076,663		probably benign	Het
Stox1	C	A	10: 62,664,848	L644F	probably damaging	Het
Sv2b	C	T	7: 75,156,753	G213E	probably damaging	Het
Tas2r121	T	G	6: 132,700,291	L239F	probably damaging	Het
Trrap	T	A	5: 144,794,793	V854E	probably damaging	Het
Vmn2r97	A	G	17: 18,947,773	Y763C	possibly damaging	Het
Xkr6	T	A	14: 63,606,911	W128R	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCAATCCAGAAACCCTAG -3'
(R):5'- ACAGGTGAACCGGCTTTTC -3'

Sequencing Primer
(F):5'- CTCTGAAAGCAACTTGAGTGTG -3'
(R):5'- GTGAACCGGCTTTTCTTACTTCATAG -3'

Posted On

2017-02-15