Incidental Mutation 'R5885:Pgbd5'
ID456043
Institutional Source Beutler Lab
Gene Symbol Pgbd5
Ensembl Gene ENSMUSG00000050751
Gene NamepiggyBac transposable element derived 5
Synonyms
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124369049-124439658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124384466 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 162 (T162M)
Ref Sequence ENSEMBL: ENSMUSP00000120984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052580] [ENSMUST00000136892] [ENSMUST00000140012] [ENSMUST00000172566]
Predicted Effect probably damaging
Transcript: ENSMUST00000052580
AA Change: T48M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054788
Gene: ENSMUSG00000050751
AA Change: T48M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136892
AA Change: T48M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123265
Gene: ENSMUSG00000050751
AA Change: T48M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140012
AA Change: T162M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120984
Gene: ENSMUSG00000050751
AA Change: T162M

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 120 486 5.6e-90 PFAM
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172566
AA Change: T71M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133560
Gene: ENSMUSG00000050751
AA Change: T71M

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 29 395 2e-86 PFAM
low complexity region 415 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Pgbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pgbd5 APN 8 124384202 missense probably benign 0.00
IGL01669:Pgbd5 APN 8 124374399 missense possibly damaging 0.86
IGL01759:Pgbd5 APN 8 124384379 missense probably damaging 1.00
IGL01762:Pgbd5 APN 8 124370610 missense probably damaging 1.00
IGL02398:Pgbd5 APN 8 124384518 missense probably damaging 1.00
R0348:Pgbd5 UTSW 8 124434032 missense probably damaging 0.98
R0702:Pgbd5 UTSW 8 124374255 missense probably benign 0.21
R0981:Pgbd5 UTSW 8 124384293 nonsense probably null
R1259:Pgbd5 UTSW 8 124370585 missense probably damaging 0.98
R1598:Pgbd5 UTSW 8 124374287 missense probably benign 0.26
R1609:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
R1742:Pgbd5 UTSW 8 124380307 missense probably damaging 1.00
R1938:Pgbd5 UTSW 8 124374249 nonsense probably null
R1985:Pgbd5 UTSW 8 124370592 missense probably benign 0.00
R2169:Pgbd5 UTSW 8 124384624 critical splice acceptor site probably null
R4573:Pgbd5 UTSW 8 124376227 nonsense probably null
R4917:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4918:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4946:Pgbd5 UTSW 8 124370585 missense possibly damaging 0.93
R5409:Pgbd5 UTSW 8 124371880 missense probably damaging 1.00
R5946:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R6907:Pgbd5 UTSW 8 124380282 missense probably damaging 0.97
R6986:Pgbd5 UTSW 8 124384473 missense possibly damaging 0.56
R7144:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R7342:Pgbd5 UTSW 8 124433970 missense probably benign 0.36
R7475:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
X0067:Pgbd5 UTSW 8 124371912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTGTAGAGCCCATG -3'
(R):5'- GATTTTGGACGTGAGCGCTC -3'

Sequencing Primer
(F):5'- CTTGTAGAGCCCATGCGTGG -3'
(R):5'- CAGCCTGTCTTTGGATTTCAG -3'
Posted On2017-02-15