Mutagenetix > Incidental Mutation

Incidental Mutation 'R5885:Itga11'

456045

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

043237-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R5885 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62762850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 752 (Y752C)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034774
AA Change: Y752C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: Y752C

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159012

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	A	T	13: 19,729,349		noncoding transcript	Het
Acot10	T	A	15: 20,666,104	M184L	probably benign	Het
Adgrv1	A	T	13: 81,424,271	S4924T	probably benign	Het
Atp10a	T	A	7: 58,813,800	M1027K	possibly damaging	Het
Axl	T	A	7: 25,766,852	K510I	probably damaging	Het
Azi2	T	A	9: 118,047,560	I48N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
Dnah3	T	C	7: 120,069,704	I720V	probably benign	Het
Dnah8	C	T	17: 30,794,717	P3811S	probably damaging	Het
Epas1	A	G	17: 86,827,544	D535G	probably damaging	Het
Fam47e	A	G	5: 92,565,968	K152R	probably damaging	Het
Fbxl3	A	T	14: 103,083,231	I260K	probably benign	Het
Fcgr3	A	G	1: 171,057,711	V115A	probably damaging	Het
Fgf12	G	T	16: 28,398,294	D98E	possibly damaging	Het
Flt3	T	C	5: 147,349,629	T716A	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Grin2a	A	G	16: 9,761,905	Y165H	possibly damaging	Het
Ifna4	T	A	4: 88,842,362	W168R	probably damaging	Het
Khdrbs3	A	G	15: 69,024,698		probably null	Het
Kif24	A	T	4: 41,423,463	Y263N	probably damaging	Het
Lama5	G	T	2: 180,201,831	T441K	probably damaging	Het
Lrrc47	T	A	4: 154,015,972	V335D	possibly damaging	Het
Map1b	A	T	13: 99,430,081	I2044N	unknown	Het
Mast2	C	T	4: 116,314,838	G638S	probably damaging	Het
Myo9a	T	C	9: 59,871,220	S1420P	probably benign	Het
Neurl2	T	C	2: 164,832,891	T184A	probably damaging	Het
Nfatc3	A	G	8: 106,096,312	I577V	probably benign	Het
Nipal3	A	T	4: 135,471,977	V186E	probably damaging	Het
Pgbd5	G	A	8: 124,384,466	T162M	probably damaging	Het
Plod2	T	A	9: 92,606,656		probably null	Het
Psg22	T	A	7: 18,718,332	L19Q	probably damaging	Het
Psg27	T	A	7: 18,561,786	N245Y	probably damaging	Het
Ptprc	T	A	1: 138,088,508	I539F	probably damaging	Het
Rad1	T	C	15: 10,488,057	L59P	probably damaging	Het
Slc2a9	G	A	5: 38,440,674	R137W	probably damaging	Het
Spats2l	C	T	1: 57,946,162	A458V	probably damaging	Het
Sptbn5	A	G	2: 120,076,663		probably benign	Het
Stox1	C	A	10: 62,664,848	L644F	probably damaging	Het
Sv2b	C	T	7: 75,156,753	G213E	probably damaging	Het
Tas2r121	T	G	6: 132,700,291	L239F	probably damaging	Het
Trrap	T	A	5: 144,794,793	V854E	probably damaging	Het
Vmn2r97	A	G	17: 18,947,773	Y763C	possibly damaging	Het
Xkr6	T	A	14: 63,606,911	W128R	probably damaging	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62735293	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1647:Itga11	UTSW	9	62760370	missense	probably benign	0.01
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R4962:Itga11	UTSW	9	62761568	nonsense	probably null
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7264:Itga11	UTSW	9	62745908	missense	probably benign	0.02
R7509:Itga11	UTSW	9	62781940	missense	probably benign
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00
R8871:Itga11	UTSW	9	62761541	nonsense	probably null
R8904:Itga11	UTSW	9	62757611	missense	probably benign
R8954:Itga11	UTSW	9	62769263	missense	possibly damaging	0.58
R8977:Itga11	UTSW	9	62755640	missense	probably damaging	0.98
R9011:Itga11	UTSW	9	62755627	missense	probably benign	0.43
R9038:Itga11	UTSW	9	62767757	missense	possibly damaging	0.90
R9089:Itga11	UTSW	9	62771380	missense	probably damaging	1.00
R9262:Itga11	UTSW	9	62752396	splice site	probably benign
R9327:Itga11	UTSW	9	62730752	missense	probably damaging	1.00
R9487:Itga11	UTSW	9	62762889	missense	probably benign	0.35
R9794:Itga11	UTSW	9	62755586	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCACATATTTCTCACCTGCAG -3'
(R):5'- CCTGCTGTTACTAGCTGTGG -3'

Sequencing Primer
(F):5'- ATTATCCACATGGGGACTTACC -3'
(R):5'- CTGTTACTAGCTGTGGGTCTC -3'

Posted On

2017-02-15