Incidental Mutation 'R5885:Azi2'
ID 456047
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name 5-azacytidine induced gene 2
Synonyms AZ2
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5885 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118040499-118069794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118047560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 48 (I48N)
Ref Sequence ENSEMBL: ENSMUSP00000122063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583]
AlphaFold Q9QYP6
Predicted Effect probably damaging
Transcript: ENSMUST00000044454
AA Change: I48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285
AA Change: I48N

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127189
Predicted Effect probably benign
Transcript: ENSMUST00000130735
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133580
AA Change: I48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285
AA Change: I48N

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134433
AA Change: I48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285
AA Change: I48N

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143024
Predicted Effect probably damaging
Transcript: ENSMUST00000154583
AA Change: I48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285
AA Change: I48N

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 118059146 missense probably damaging 0.97
awry UTSW 9 118047419 start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 118055841 missense possibly damaging 0.82
R0636:Azi2 UTSW 9 118062057 missense probably benign 0.03
R2024:Azi2 UTSW 9 118049322 nonsense probably null
R3498:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R3713:Azi2 UTSW 9 118047440 missense possibly damaging 0.65
R3899:Azi2 UTSW 9 118047503 missense probably damaging 1.00
R4765:Azi2 UTSW 9 118061471 unclassified probably benign
R5227:Azi2 UTSW 9 118047458 missense probably damaging 1.00
R5839:Azi2 UTSW 9 118059119 missense probably damaging 1.00
R6021:Azi2 UTSW 9 118047419 start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 118049338 missense probably damaging 0.96
R6408:Azi2 UTSW 9 118061482 nonsense probably null
R6525:Azi2 UTSW 9 118047595 missense probably damaging 0.96
R6889:Azi2 UTSW 9 118049895 critical splice acceptor site probably null
R7391:Azi2 UTSW 9 118050892 splice site probably null
R7693:Azi2 UTSW 9 118047593 missense probably damaging 1.00
R7889:Azi2 UTSW 9 118061915 missense probably benign 0.20
R8042:Azi2 UTSW 9 118062097 missense probably benign 0.01
R8142:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R8784:Azi2 UTSW 9 118055892 missense probably benign
R8929:Azi2 UTSW 9 118049976 missense probably damaging 1.00
R9800:Azi2 UTSW 9 118055856 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCTGTGTTGCCTCTGAAAG -3'
(R):5'- ACACACGATATGACTGATGCAGC -3'

Sequencing Primer
(F):5'- GCTGTGTTGCCTCTGAAAGAAAATAG -3'
(R):5'- CGATATGACTGATGCAGCATAGTTAG -3'
Posted On 2017-02-15