Incidental Mutation 'R5885:Stox1'
ID456048
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Namestorkhead box 1
Synonyms4732470K04Rik
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62659043-62726128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62664848 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 644 (L644F)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126979] [ENSMUST00000133371] [ENSMUST00000148720]
Predicted Effect probably benign
Transcript: ENSMUST00000126979
Predicted Effect probably damaging
Transcript: ENSMUST00000133371
AA Change: L644F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: L644F

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148720
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218980
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62667913 missense probably damaging 1.00
IGL01462:Stox1 APN 10 62664682 missense probably benign 0.14
IGL01558:Stox1 APN 10 62667872 missense probably damaging 0.98
IGL02391:Stox1 APN 10 62659676 splice site probably benign
IGL02454:Stox1 APN 10 62667826 missense probably damaging 1.00
IGL02510:Stox1 APN 10 62664047 missense probably benign 0.14
IGL02635:Stox1 APN 10 62664906 missense probably benign 0.02
R1036:Stox1 UTSW 10 62667895 missense probably damaging 1.00
R1486:Stox1 UTSW 10 62664636 missense probably benign 0.06
R1751:Stox1 UTSW 10 62659666 missense probably damaging 0.97
R1763:Stox1 UTSW 10 62667965 missense probably damaging 1.00
R1892:Stox1 UTSW 10 62665399 missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62664535 missense probably benign 0.42
R2406:Stox1 UTSW 10 62664166 missense probably benign 0.01
R4078:Stox1 UTSW 10 62666031 missense probably benign 0.00
R4414:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4415:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4416:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4417:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4799:Stox1 UTSW 10 62665737 missense probably damaging 1.00
R5261:Stox1 UTSW 10 62667841 missense probably damaging 0.98
R5323:Stox1 UTSW 10 62664033 missense possibly damaging 0.71
R6182:Stox1 UTSW 10 62664942 missense probably damaging 0.99
R7548:Stox1 UTSW 10 62666167 missense probably damaging 0.99
R7757:Stox1 UTSW 10 62663964 missense probably damaging 1.00
R7765:Stox1 UTSW 10 62665999 missense probably benign 0.26
R7846:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7867:Stox1 UTSW 10 62664944 missense probably benign 0.00
R8077:Stox1 UTSW 10 62665566 missense probably damaging 1.00
R8409:Stox1 UTSW 10 62666016 missense probably benign 0.00
R8413:Stox1 UTSW 10 62664975 missense probably damaging 1.00
R8443:Stox1 UTSW 10 62665764 missense probably damaging 1.00
R8822:Stox1 UTSW 10 62664121 missense probably damaging 1.00
R8888:Stox1 UTSW 10 62659607 missense not run
R8895:Stox1 UTSW 10 62659607 missense not run
RF014:Stox1 UTSW 10 62664246 missense probably benign 0.06
Z1176:Stox1 UTSW 10 62664018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGCCTCAGGGATTTGTAATG -3'
(R):5'- AGCGACGATTTCAGAGGTGG -3'

Sequencing Primer
(F):5'- GGGATTTGTAATGCCTTTCTACTTAG -3'
(R):5'- CTCCACGTAGAGTTTTGCCAGG -3'
Posted On2017-02-15