Incidental Mutation 'R5885:Gad1-ps'
ID 456049
Institutional Source Beutler Lab
Gene Symbol Gad1-ps
Ensembl Gene ENSMUSG00000090665
Gene Name glutamate decarboxylase 1, pseudogene
Synonyms Gad-1ps
MMRRC Submission 043237-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R5885 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99279906-99281681 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) G to A at 99281009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167243
SMART Domains Protein: ENSMUSP00000133048
Gene: ENSMUSG00000090665

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 1 368 4.3e-153 PFAM
Pfam:Beta_elim_lyase 91 436 7.3e-8 PFAM
Pfam:Aminotran_5 130 370 4.7e-7 PFAM
Meta Mutation Damage Score 0.2911 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T A 15: 20,666,190 (GRCm39) M184L probably benign Het
Adgrv1 A T 13: 81,572,390 (GRCm39) S4924T probably benign Het
Atp10a T A 7: 58,463,548 (GRCm39) M1027K possibly damaging Het
Axl T A 7: 25,466,277 (GRCm39) K510I probably damaging Het
Azi2 T A 9: 117,876,628 (GRCm39) I48N probably damaging Het
Cysltr2 T C 14: 73,266,931 (GRCm39) K260E probably benign Het
Dnah3 T C 7: 119,668,927 (GRCm39) I720V probably benign Het
Dnah8 C T 17: 31,013,691 (GRCm39) P3811S probably damaging Het
Epas1 A G 17: 87,134,972 (GRCm39) D535G probably damaging Het
Fam47e A G 5: 92,713,827 (GRCm39) K152R probably damaging Het
Fbxl3 A T 14: 103,320,667 (GRCm39) I260K probably benign Het
Fcgr3 A G 1: 170,885,280 (GRCm39) V115A probably damaging Het
Fgf12 G T 16: 28,217,046 (GRCm39) D98E possibly damaging Het
Flt3 T C 5: 147,286,439 (GRCm39) T716A probably damaging Het
Gpr141b A T 13: 19,913,519 (GRCm39) noncoding transcript Het
Grin2a A G 16: 9,579,769 (GRCm39) Y165H possibly damaging Het
Ifna4 T A 4: 88,760,599 (GRCm39) W168R probably damaging Het
Itga11 A G 9: 62,670,132 (GRCm39) Y752C probably damaging Het
Khdrbs3 A G 15: 68,896,547 (GRCm39) probably null Het
Kif24 A T 4: 41,423,463 (GRCm39) Y263N probably damaging Het
Lama5 G T 2: 179,843,624 (GRCm39) T441K probably damaging Het
Lrrc47 T A 4: 154,100,429 (GRCm39) V335D possibly damaging Het
Map1b A T 13: 99,566,589 (GRCm39) I2044N unknown Het
Mast2 C T 4: 116,172,035 (GRCm39) G638S probably damaging Het
Myo9a T C 9: 59,778,503 (GRCm39) S1420P probably benign Het
Neurl2 T C 2: 164,674,811 (GRCm39) T184A probably damaging Het
Nfatc3 A G 8: 106,822,944 (GRCm39) I577V probably benign Het
Nipal3 A T 4: 135,199,288 (GRCm39) V186E probably damaging Het
Pgbd5 G A 8: 125,111,205 (GRCm39) T162M probably damaging Het
Plod2 T A 9: 92,488,709 (GRCm39) probably null Het
Psg22 T A 7: 18,452,257 (GRCm39) L19Q probably damaging Het
Psg27 T A 7: 18,295,711 (GRCm39) N245Y probably damaging Het
Ptprc T A 1: 138,016,246 (GRCm39) I539F probably damaging Het
Rad1 T C 15: 10,488,143 (GRCm39) L59P probably damaging Het
Slc2a9 G A 5: 38,598,017 (GRCm39) R137W probably damaging Het
Spats2l C T 1: 57,985,321 (GRCm39) A458V probably damaging Het
Sptbn5 A G 2: 119,907,144 (GRCm39) probably benign Het
Stox1 C A 10: 62,500,627 (GRCm39) L644F probably damaging Het
Sv2b C T 7: 74,806,501 (GRCm39) G213E probably damaging Het
Tas2r121 T G 6: 132,677,254 (GRCm39) L239F probably damaging Het
Trrap T A 5: 144,731,603 (GRCm39) V854E probably damaging Het
Vmn2r97 A G 17: 19,168,035 (GRCm39) Y763C possibly damaging Het
Xkr6 T A 14: 63,844,360 (GRCm39) W128R probably damaging Het
Other mutations in Gad1-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Gad1-ps APN 10 99,281,310 (GRCm39) exon noncoding transcript
IGL01301:Gad1-ps APN 10 99,281,013 (GRCm39) exon noncoding transcript
IGL01394:Gad1-ps APN 10 99,281,424 (GRCm39) exon noncoding transcript
IGL02220:Gad1-ps APN 10 99,281,184 (GRCm39) exon noncoding transcript
IGL02240:Gad1-ps APN 10 99,280,820 (GRCm39) exon noncoding transcript
IGL03406:Gad1-ps APN 10 99,280,641 (GRCm39) exon noncoding transcript
ANU18:Gad1-ps UTSW 10 99,281,013 (GRCm39) exon noncoding transcript
R0305:Gad1-ps UTSW 10 99,280,665 (GRCm39) exon noncoding transcript
R0446:Gad1-ps UTSW 10 99,281,383 (GRCm39) exon noncoding transcript
R0538:Gad1-ps UTSW 10 99,280,854 (GRCm39) exon noncoding transcript
R1511:Gad1-ps UTSW 10 99,281,331 (GRCm39) exon noncoding transcript
R1734:Gad1-ps UTSW 10 99,281,637 (GRCm39) exon noncoding transcript
R1745:Gad1-ps UTSW 10 99,281,386 (GRCm39) exon noncoding transcript
R1886:Gad1-ps UTSW 10 99,281,444 (GRCm39) exon noncoding transcript
R3111:Gad1-ps UTSW 10 99,280,383 (GRCm39) exon noncoding transcript
R3617:Gad1-ps UTSW 10 99,281,260 (GRCm39) exon noncoding transcript
R5042:Gad1-ps UTSW 10 99,281,516 (GRCm39) exon noncoding transcript
R5223:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5234:Gad1-ps UTSW 10 99,281,188 (GRCm39) exon noncoding transcript
R5275:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5295:Gad1-ps UTSW 10 99,280,751 (GRCm39) exon noncoding transcript
R5334:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5335:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5336:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5337:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5396:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5397:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5399:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5428:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5429:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5431:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
R5661:Gad1-ps UTSW 10 99,280,901 (GRCm39) exon noncoding transcript
R5667:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5671:Gad1-ps UTSW 10 99,280,395 (GRCm39) exon noncoding transcript
R5886:Gad1-ps UTSW 10 99,281,009 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGCTTTGGAACAGACAATGTG -3'
(R):5'- AGAGGTAGCCTGCACACATC -3'

Sequencing Primer
(F):5'- GCTTTGGAACAGACAATGTGATTTTG -3'
(R):5'- ACATCTGGCTGCATCCTTGGAG -3'
Posted On 2017-02-15