Incidental Mutation 'R5885:Acot10'
ID456059
Institutional Source Beutler Lab
Gene Symbol Acot10
Ensembl Gene ENSMUSG00000047565
Gene Nameacyl-CoA thioesterase 10
SynonymsMT-ACT48, p48, Acate3
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location20665214-20666750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20666104 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 184 (M184L)
Ref Sequence ENSEMBL: ENSMUSP00000051333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052910]
Predicted Effect probably benign
Transcript: ENSMUST00000052910
AA Change: M184L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051333
Gene: ENSMUSG00000047565
AA Change: M184L

DomainStartEndE-ValueType
SCOP:d1lo7a_ 108 222 1e-4 SMART
PDB:4IEN|D 277 400 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228652
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Acot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Acot10 APN 15 20665965 missense probably benign 0.11
IGL01610:Acot10 APN 15 20665695 missense probably damaging 1.00
IGL02457:Acot10 APN 15 20666143 missense possibly damaging 0.88
IGL02587:Acot10 APN 15 20665797 missense possibly damaging 0.93
IGL02951:Acot10 APN 15 20665782 missense probably benign 0.36
ANU23:Acot10 UTSW 15 20665965 missense probably benign 0.11
PIT4151001:Acot10 UTSW 15 20666598 missense probably damaging 0.98
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0026:Acot10 UTSW 15 20666236 missense probably benign 0.10
R0462:Acot10 UTSW 15 20666626 missense possibly damaging 0.85
R1312:Acot10 UTSW 15 20666499 missense probably benign 0.00
R1495:Acot10 UTSW 15 20665507 missense probably damaging 0.99
R2128:Acot10 UTSW 15 20666626 missense probably benign 0.00
R3779:Acot10 UTSW 15 20665542 missense probably damaging 0.98
R4110:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4111:Acot10 UTSW 15 20666526 missense probably damaging 1.00
R4464:Acot10 UTSW 15 20665744 nonsense probably null
R4668:Acot10 UTSW 15 20665942 missense probably benign
R4933:Acot10 UTSW 15 20666330 missense possibly damaging 0.88
R5255:Acot10 UTSW 15 20665932 missense probably benign 0.01
R6190:Acot10 UTSW 15 20665785 missense possibly damaging 0.80
R6301:Acot10 UTSW 15 20666262 missense probably benign 0.05
R6805:Acot10 UTSW 15 20665366 missense probably benign 0.42
R7334:Acot10 UTSW 15 20665543 missense possibly damaging 0.86
R7601:Acot10 UTSW 15 20665629 missense probably damaging 1.00
R8400:Acot10 UTSW 15 20666172 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GAACTGGGAGCCACTTTCAG -3'
(R):5'- CAGCTTAGGAGTTCTTGTTTGCTAC -3'

Sequencing Primer
(F):5'- CTGGGAGCCACTTTCAGTAATGAAC -3'
(R):5'- GCTACATGCACAACCACAATCATTC -3'
Posted On2017-02-15