Incidental Mutation 'R5885:Khdrbs3'
ID456060
Institutional Source Beutler Lab
Gene Symbol Khdrbs3
Ensembl Gene ENSMUSG00000022332
Gene NameKH domain containing, RNA binding, signal transduction associated 3
SynonymsT-STAR, SLM-2, Etle, Salp
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location68928420-69101211 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 69024698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022954] [ENSMUST00000229234] [ENSMUST00000229683] [ENSMUST00000230073] [ENSMUST00000230847]
Predicted Effect probably null
Transcript: ENSMUST00000022954
SMART Domains Protein: ENSMUSP00000022954
Gene: ENSMUSG00000022332

DomainStartEndE-ValueType
PDB:2XA6|B 2 27 2e-7 PDB
low complexity region 30 44 N/A INTRINSIC
KH 54 152 8.92e-5 SMART
Pfam:Sam68-YY 266 320 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229234
Predicted Effect probably benign
Transcript: ENSMUST00000229683
Predicted Effect probably null
Transcript: ENSMUST00000230073
Predicted Effect probably null
Transcript: ENSMUST00000230847
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no detectable spatial memory deficits. Males sire slightly smaller litters than control males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Khdrbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Khdrbs3 APN 15 69049394 missense probably damaging 1.00
IGL02756:Khdrbs3 APN 15 69024836 missense probably benign 0.28
IGL03303:Khdrbs3 APN 15 69024823 missense probably benign 0.00
R0014:Khdrbs3 UTSW 15 69024835 missense probably benign 0.00
R0066:Khdrbs3 UTSW 15 68995037 splice site probably benign
R0487:Khdrbs3 UTSW 15 69017361 missense probably damaging 1.00
R1500:Khdrbs3 UTSW 15 68928786 missense possibly damaging 0.90
R1871:Khdrbs3 UTSW 15 69049442 missense probably damaging 1.00
R2002:Khdrbs3 UTSW 15 69013479 intron probably benign
R2111:Khdrbs3 UTSW 15 69024824 missense probably benign 0.25
R2191:Khdrbs3 UTSW 15 69092960 missense probably damaging 0.96
R2290:Khdrbs3 UTSW 15 69029761 missense probably damaging 1.00
R2516:Khdrbs3 UTSW 15 69024695 splice site probably benign
R2940:Khdrbs3 UTSW 15 69049390 missense probably damaging 1.00
R3418:Khdrbs3 UTSW 15 69049375 splice site probably benign
R5770:Khdrbs3 UTSW 15 69049463 critical splice donor site probably null
R6829:Khdrbs3 UTSW 15 69092961 missense possibly damaging 0.58
R7288:Khdrbs3 UTSW 15 69049413 missense possibly damaging 0.95
Z1176:Khdrbs3 UTSW 15 69017467 missense probably damaging 1.00
Z1177:Khdrbs3 UTSW 15 68928831 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGAGAGACATTAGCTTACCTG -3'
(R):5'- AATGGCAGCAACTTTCACACTG -3'

Sequencing Primer
(F):5'- CCTGTAATTTTAGTATGGGGGAAAC -3'
(R):5'- AACTTTCACACTGCTGCAATGG -3'
Posted On2017-02-15