Incidental Mutation 'R5885:Fgf12'
ID 456062
Institutional Source Beutler Lab
Gene Symbol Fgf12
Ensembl Gene ENSMUSG00000022523
Gene Name fibroblast growth factor 12
Synonyms Fhf1
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5885 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 28160098-28753068 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 28398294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 98 (D98E)
Ref Sequence ENSEMBL: ENSMUSP00000156274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100024] [ENSMUST00000231399] [ENSMUST00000231717] [ENSMUST00000232352]
AlphaFold P61329
Predicted Effect probably benign
Transcript: ENSMUST00000100024
AA Change: D98E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097601
Gene: ENSMUSG00000022523
AA Change: D98E

DomainStartEndE-ValueType
FGF 71 202 1.22e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231399
AA Change: D62E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231717
AA Change: D98E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000232352
AA Change: D36E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This growth factor lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, this protein accumulated in the nucleus, but was not secreted. The specific function of this gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and do not exhibit any significant behavioral or neurological phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Fgf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Fgf12 APN 16 28189599 missense possibly damaging 0.86
R0420:Fgf12 UTSW 16 28162529 missense possibly damaging 0.77
R0519:Fgf12 UTSW 16 28189628 missense probably benign 0.34
R0968:Fgf12 UTSW 16 28162433 missense probably null 0.00
R1216:Fgf12 UTSW 16 28162450 missense possibly damaging 0.51
R1686:Fgf12 UTSW 16 28398341 missense probably damaging 0.99
R2263:Fgf12 UTSW 16 28189611 nonsense probably null
R7170:Fgf12 UTSW 16 28445179 missense probably benign 0.13
R8856:Fgf12 UTSW 16 28189481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCATAGCCTCTCTGATATAGTG -3'
(R):5'- ACTGACCCCTTTCCAAATGC -3'

Sequencing Primer
(F):5'- GTCTAGCTCACTGATCATC -3'
(R):5'- CAATATTTATGACACGGGCATTTATG -3'
Posted On 2017-02-15