Incidental Mutation 'R5885:Epas1'
ID456066
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Nameendothelial PAS domain protein 1
SynonymsHIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5885 (G1)
Quality Score205
Status Not validated
Chromosome17
Chromosomal Location86753907-86833410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86827544 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 535 (D535G)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
Predicted Effect probably damaging
Transcript: ENSMUST00000024954
AA Change: D535G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: D535G

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 86823729 missense probably damaging 1.00
IGL02150:Epas1 APN 17 86805289 missense probably damaging 1.00
IGL02221:Epas1 APN 17 86827847 missense possibly damaging 0.50
IGL02555:Epas1 APN 17 86829064 missense probably benign
IGL02739:Epas1 APN 17 86805282 missense probably damaging 0.98
IGL03389:Epas1 APN 17 86823703 missense probably benign 0.10
R0043:Epas1 UTSW 17 86823812 missense probably damaging 0.99
R0363:Epas1 UTSW 17 86805848 splice site probably benign
R0399:Epas1 UTSW 17 86805193 missense probably benign 0.01
R0737:Epas1 UTSW 17 86829456 missense possibly damaging 0.45
R1542:Epas1 UTSW 17 86824490 missense possibly damaging 0.67
R1662:Epas1 UTSW 17 86829027 missense probably damaging 0.99
R1885:Epas1 UTSW 17 86805295 missense probably damaging 1.00
R2197:Epas1 UTSW 17 86829043 missense probably benign 0.01
R3056:Epas1 UTSW 17 86830981 missense probably damaging 0.99
R4342:Epas1 UTSW 17 86823800 missense probably damaging 1.00
R4391:Epas1 UTSW 17 86809663 missense probably benign 0.00
R4774:Epas1 UTSW 17 86805758 missense probably damaging 1.00
R4798:Epas1 UTSW 17 86805839 missense probably benign
R4989:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5133:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5604:Epas1 UTSW 17 86805772 missense probably damaging 1.00
R5811:Epas1 UTSW 17 86823775 missense probably damaging 1.00
R5838:Epas1 UTSW 17 86823686 missense possibly damaging 0.94
R5932:Epas1 UTSW 17 86827646 missense possibly damaging 0.66
R6045:Epas1 UTSW 17 86809399 missense probably damaging 0.99
R6145:Epas1 UTSW 17 86829429 missense probably benign 0.01
R7517:Epas1 UTSW 17 86831098 missense possibly damaging 0.92
R7552:Epas1 UTSW 17 86829043 missense probably benign 0.01
R7828:Epas1 UTSW 17 86827699 missense probably benign 0.04
R8081:Epas1 UTSW 17 86829369 missense probably benign
R8111:Epas1 UTSW 17 86818432 nonsense probably null
R8558:Epas1 UTSW 17 86809468 missense possibly damaging 0.89
Z1176:Epas1 UTSW 17 86827946 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAAATCTGAGCAGTTCCAG -3'
(R):5'- GCTCCCAGCATCAAAGAAGATG -3'

Sequencing Primer
(F):5'- TCTGAGCAGTTCCAGCAGAG -3'
(R):5'- AAGACATGGGCCAGTGCTC -3'
Posted On2017-02-15