Incidental Mutation 'R5886:Vps39'
ID456076
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 120321572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect probably benign
Transcript: ENSMUST00000028752
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102501
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147085
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120345638 missense probably damaging 1.00
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5483:Vps39 UTSW 2 120323083 missense probably benign 0.08
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6004:Vps39 UTSW 2 120345650 missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
R6915:Vps39 UTSW 2 120321031 nonsense probably null
R7535:Vps39 UTSW 2 120324695 missense probably damaging 1.00
R7780:Vps39 UTSW 2 120325199 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACCTCATCCTAGGGACAGG -3'
(R):5'- CTCACAGAGATGAGCAGCCATG -3'

Sequencing Primer
(F):5'- TCATCCTAGGGACAGGGTGGG -3'
(R):5'- AGAGGGCATTTCACCTCCC -3'
Posted On2017-02-15