Incidental Mutation 'R5886:Tacc2'
ID456088
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130729120 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 378 (D378G)
Ref Sequence ENSEMBL: ENSMUSP00000146718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208722] [ENSMUST00000208743] [ENSMUST00000209108]
Predicted Effect probably benign
Transcript: ENSMUST00000033141
AA Change: D268G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059145
AA Change: D378G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: D378G

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: D2085G

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: D2085G

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207282
AA Change: D268G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000207376
Predicted Effect probably benign
Transcript: ENSMUST00000207395
AA Change: D124G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000207549
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably benign
Transcript: ENSMUST00000208722
AA Change: D378G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000208743
AA Change: D268G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000209108
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7651:Tacc2 UTSW 7 130623154 missense probably benign 0.25
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
R7861:Tacc2 UTSW 7 130625431 missense probably benign 0.00
R7944:Tacc2 UTSW 7 130625431 missense probably benign 0.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130623370 missense not run
Z1176:Tacc2 UTSW 7 130624270 missense not run
Z1176:Tacc2 UTSW 7 130744597 missense not run
Z1177:Tacc2 UTSW 7 130624980 missense not run
Z1177:Tacc2 UTSW 7 130625774 missense not run
Z1177:Tacc2 UTSW 7 130734949 missense not run
Predicted Primers PCR Primer
(F):5'- AAACACGGCCACCTTCCTTG -3'
(R):5'- GTCAAACTCCAGCCTCACTG -3'

Sequencing Primer
(F):5'- GGCCACCTTCCTTGAAAAAG -3'
(R):5'- AACCCCTTGGCAGGCAAG -3'
Posted On2017-02-15