Mutagenetix > Incidental Mutations

Incidental Mutation 'R5886:Slfn8'

456104

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

044088-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5886 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83003334 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 826 (M826I)

Ref Sequence

ENSEMBL: ENSMUSP00000090513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

Predicted Effect

probably benign
Transcript: ENSMUST00000038141
AA Change: M826I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M826I

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092838
AA Change: M826I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M826I

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108152

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130822

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131883

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215239

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.2%
20x: 91.0%

Validation Efficiency

96% (78/81)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	A	G	11: 103,208,121		probably null	Het
9930021J03Rik	T	C	19: 29,719,277	I939V	probably benign	Het
Acap1	A	G	11: 69,884,336	V367A	probably benign	Het
Adam26b	T	C	8: 43,520,273	E564G	possibly damaging	Het
Akap1	A	G	11: 88,834,660		probably null	Het
Akap2	T	A	4: 57,856,295	D582E	probably damaging	Het
Akap5	T	A	12: 76,327,845	V10E	possibly damaging	Het
Atad2	A	T	15: 58,098,514	L887*	probably null	Het
C1qbp	A	G	11: 70,982,182	V122A	probably benign	Het
C1qtnf7	G	A	5: 43,615,656	G92D	probably damaging	Het
Cacna1a	T	C	8: 84,523,022	I219T	probably damaging	Het
Capn12	A	G	7: 28,887,605	N333S	probably benign	Het
Ccdc154	C	T	17: 25,171,818	T644I	probably benign	Het
Cd200r1	T	C	16: 44,790,203	S225P	possibly damaging	Het
Cntnap5a	T	C	1: 116,571,672		probably null	Het
Coq4	A	T	2: 29,790,614		probably benign	Het
Cubn	A	T	2: 13,320,023		probably benign	Het
Cyp4f17	A	T	17: 32,524,039	S229C	possibly damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
D930007J09Rik	C	A	13: 32,802,836	A200E	probably benign	Het
Dnah8	C	T	17: 30,794,717	P3811S	probably damaging	Het
Duoxa1	A	T	2: 122,303,810	S276T	possibly damaging	Het
Efhb	T	C	17: 53,451,554	I351M	probably benign	Het
Fat1	G	A	8: 45,027,681		probably null	Het
Fat1	A	T	8: 45,033,395	T3329S	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gm29376	A	G	1: 134,520,199		noncoding transcript	Het
Gm973	T	A	1: 59,558,250		probably benign	Het
Gpr156	T	A	16: 37,979,013	L124Q	probably damaging	Het
Hars2	T	A	18: 36,790,097		probably benign	Het
Hcrt	G	A	11: 100,761,933	A85V	probably damaging	Het
Hivep1	A	G	13: 42,156,612	D776G	probably damaging	Het
Hmgcr	A	T	13: 96,660,183	S200T	probably damaging	Het
Krt40	C	T	11: 99,540,081	A201T	probably benign	Het
Lca5	G	A	9: 83,399,681	A350V	probably benign	Het
Lrig2	T	A	3: 104,462,698	M515L	probably benign	Het
Mbd5	A	G	2: 49,272,452	D90G	probably damaging	Het
Mfsd4a	C	T	1: 132,067,727	V56I	probably damaging	Het
Mpi	A	G	9: 57,548,462		probably benign	Het
Mroh4	G	T	15: 74,606,447	D935E	possibly damaging	Het
Mtg1	G	T	7: 140,149,865		probably null	Het
Nanos1	T	A	19: 60,756,830	C189S	probably damaging	Het
Naprt	A	C	15: 75,891,475		probably null	Het
Nubpl	T	A	12: 52,181,309		probably null	Het
Olfr1016	A	G	2: 85,799,803	S156P	probably damaging	Het
Olfr286	T	C	15: 98,226,791	T285A	possibly damaging	Het
Olfr937	T	A	9: 39,060,382	T95S	probably benign	Het
Olfr963	G	T	9: 39,669,956	V300L	probably benign	Het
Otud4	T	A	8: 79,672,807	Y717N	probably damaging	Het
Pnpla1	T	C	17: 28,876,863	F86S	possibly damaging	Het
Prlhr	C	T	19: 60,467,576	W184*	probably null	Het
Rtp3	A	G	9: 110,987,136	S116P	probably damaging	Het
Sema3c	T	C	5: 17,681,986	I345T	possibly damaging	Het
Skor2	T	C	18: 76,859,429	L282P	unknown	Het
Slc24a4	T	C	12: 102,260,415	V468A	probably damaging	Het
Tacc2	A	G	7: 130,729,120	D378G	probably benign	Het
Thbs3	C	A	3: 89,220,163	D370E	probably damaging	Het
Tk1	CC	GA	11: 117,817,122		probably benign	Het
Tm7sf2	A	G	19: 6,066,542		probably benign	Het
Trappc8	T	C	18: 20,874,680	Y126C	probably damaging	Het
Trim35	C	G	14: 66,304,053	L209V	possibly damaging	Het
Trim35	T	C	14: 66,304,054	L209P	probably damaging	Het
Trip12	C	T	1: 84,730,458		probably benign	Het
Trp53bp1	A	G	2: 121,205,021	V1583A	probably damaging	Het
Tubgcp6	A	T	15: 89,103,247	N1166K	possibly damaging	Het
Usp54	C	T	14: 20,561,842	D969N	probably benign	Het
Vldlr	C	A	19: 27,243,771	S612R	probably benign	Het
Vps13a	T	C	19: 16,664,562	T2234A	probably benign	Het
Vps39	A	G	2: 120,321,572		probably benign	Het
Zdhhc3	A	T	9: 123,091,081	C120S	probably benign	Het
Zfp37	A	G	4: 62,191,234	F531S	probably damaging	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	splice site	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8517:Slfn8	UTSW	11	83004142	missense	possibly damaging	0.68
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CCAGGCAGAGCAATAGGTTG -3'
(R):5'- GAGATAACCCTCCATGCAGC -3'

Sequencing Primer
(F):5'- GTGGGAAATGGGCTGCTCAG -3'
(R):5'- GTCCATGAATTTAAGTGGTCCC -3'

Posted On

2017-02-15