Incidental Mutation 'R5886:Krt40'
ID456106
Institutional Source Beutler Lab
Gene Symbol Krt40
Ensembl Gene ENSMUSG00000059169
Gene Namekeratin 40
SynonymsKa36
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99537485-99543158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99540081 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 201 (A201T)
Ref Sequence ENSEMBL: ENSMUSP00000103067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074253] [ENSMUST00000107443]
Predicted Effect probably benign
Transcript: ENSMUST00000074253
AA Change: A281T

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073869
Gene: ENSMUSG00000059169
AA Change: A281T

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Filament 88 399 1.07e-139 SMART
internal_repeat_1 409 419 9.76e-5 PROSPERO
internal_repeat_1 417 427 9.76e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000107443
AA Change: A201T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103067
Gene: ENSMUSG00000059169
AA Change: A201T

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Filament 88 149 4.8e-19 PFAM
Pfam:Filament 146 319 6.1e-50 PFAM
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Krt40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Krt40 APN 11 99541219 missense probably damaging 1.00
IGL01483:Krt40 APN 11 99542727 missense probably damaging 1.00
IGL01621:Krt40 APN 11 99542868 missense probably damaging 1.00
IGL01921:Krt40 APN 11 99543163 unclassified probably benign
IGL02095:Krt40 APN 11 99541671 missense probably damaging 0.98
IGL02735:Krt40 APN 11 99538635 missense probably damaging 1.00
IGL02960:Krt40 APN 11 99539867 splice site probably null
IGL02965:Krt40 APN 11 99541666 missense probably damaging 1.00
IGL03168:Krt40 APN 11 99543028 missense possibly damaging 0.87
IGL03240:Krt40 APN 11 99537568 missense probably damaging 1.00
IGL03387:Krt40 APN 11 99539885 missense probably damaging 1.00
R0178:Krt40 UTSW 11 99541739 missense probably damaging 0.99
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0389:Krt40 UTSW 11 99541714 nonsense probably null
R1104:Krt40 UTSW 11 99540233 missense probably damaging 1.00
R2018:Krt40 UTSW 11 99540087 missense probably damaging 1.00
R2022:Krt40 UTSW 11 99539992 missense probably damaging 1.00
R4498:Krt40 UTSW 11 99543074 missense possibly damaging 0.53
R4716:Krt40 UTSW 11 99540219 missense probably damaging 1.00
R6232:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6233:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6235:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6248:Krt40 UTSW 11 99541740 missense possibly damaging 0.95
R7064:Krt40 UTSW 11 99540128 missense probably benign 0.32
R7400:Krt40 UTSW 11 99543143 missense probably benign 0.00
R7589:Krt40 UTSW 11 99540157 missense probably damaging 1.00
R7831:Krt40 UTSW 11 99541261 missense probably benign 0.06
R7838:Krt40 UTSW 11 99540135 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGGCTGGCACTGTTCATCC -3'
(R):5'- ATTTCCACCCACAGGAGGTC -3'

Sequencing Primer
(F):5'- CAATTTCCAGAGTGTTGGCC -3'
(R):5'- AGGTCAACCTGCTTCGTGAG -3'
Posted On2017-02-15