Incidental Mutation 'R5886:Usp54'
ID456116
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20561842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 969 (D969N)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: D969N

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: D969N

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: D969N

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: D969N

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hars2 T A 18: 36,790,097 probably benign Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 unclassified probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
R7859:Usp54 UTSW 14 20588136 missense probably benign 0.24
R7942:Usp54 UTSW 14 20588136 missense probably benign 0.24
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTGCATGGGGTCAGCAG -3'
(R):5'- TTTGAGGTGGACAGCGTCAATC -3'

Sequencing Primer
(F):5'- CATGGGGTCAGCAGCATGAAG -3'
(R):5'- AATCGCTCTGCATTCCACAGG -3'
Posted On2017-02-15