Incidental Mutation 'R5886:Hars2'
ID456133
Institutional Source Beutler Lab
Gene Symbol Hars2
Ensembl Gene ENSMUSG00000019143
Gene Namehistidyl-tRNA synthetase 2
SynonymsHarsl, HARSR, HO3
MMRRC Submission 044088-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5886 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36783008-36792562 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 36790097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001419
SMART Domains Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

DomainStartEndE-ValueType
ZnF_U1 77 111 2.41e-11 SMART
ZnF_C2H2 80 104 5.48e0 SMART
coiled coil region 118 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019287
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect probably benign
Transcript: ENSMUST00000152954
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155842
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik A G 11: 103,208,121 probably null Het
9930021J03Rik T C 19: 29,719,277 I939V probably benign Het
Acap1 A G 11: 69,884,336 V367A probably benign Het
Adam26b T C 8: 43,520,273 E564G possibly damaging Het
Akap1 A G 11: 88,834,660 probably null Het
Akap2 T A 4: 57,856,295 D582E probably damaging Het
Akap5 T A 12: 76,327,845 V10E possibly damaging Het
Atad2 A T 15: 58,098,514 L887* probably null Het
C1qbp A G 11: 70,982,182 V122A probably benign Het
C1qtnf7 G A 5: 43,615,656 G92D probably damaging Het
Cacna1a T C 8: 84,523,022 I219T probably damaging Het
Capn12 A G 7: 28,887,605 N333S probably benign Het
Ccdc154 C T 17: 25,171,818 T644I probably benign Het
Cd200r1 T C 16: 44,790,203 S225P possibly damaging Het
Cntnap5a T C 1: 116,571,672 probably null Het
Coq4 A T 2: 29,790,614 probably benign Het
Cubn A T 2: 13,320,023 probably benign Het
Cyp4f17 A T 17: 32,524,039 S229C possibly damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D930007J09Rik C A 13: 32,802,836 A200E probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Duoxa1 A T 2: 122,303,810 S276T possibly damaging Het
Efhb T C 17: 53,451,554 I351M probably benign Het
Fat1 G A 8: 45,027,681 probably null Het
Fat1 A T 8: 45,033,395 T3329S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm29376 A G 1: 134,520,199 noncoding transcript Het
Gm973 T A 1: 59,558,250 probably benign Het
Gpr156 T A 16: 37,979,013 L124Q probably damaging Het
Hcrt G A 11: 100,761,933 A85V probably damaging Het
Hivep1 A G 13: 42,156,612 D776G probably damaging Het
Hmgcr A T 13: 96,660,183 S200T probably damaging Het
Krt40 C T 11: 99,540,081 A201T probably benign Het
Lca5 G A 9: 83,399,681 A350V probably benign Het
Lrig2 T A 3: 104,462,698 M515L probably benign Het
Mbd5 A G 2: 49,272,452 D90G probably damaging Het
Mfsd4a C T 1: 132,067,727 V56I probably damaging Het
Mpi A G 9: 57,548,462 probably benign Het
Mroh4 G T 15: 74,606,447 D935E possibly damaging Het
Mtg1 G T 7: 140,149,865 probably null Het
Nanos1 T A 19: 60,756,830 C189S probably damaging Het
Naprt A C 15: 75,891,475 probably null Het
Nubpl T A 12: 52,181,309 probably null Het
Olfr1016 A G 2: 85,799,803 S156P probably damaging Het
Olfr286 T C 15: 98,226,791 T285A possibly damaging Het
Olfr937 T A 9: 39,060,382 T95S probably benign Het
Olfr963 G T 9: 39,669,956 V300L probably benign Het
Otud4 T A 8: 79,672,807 Y717N probably damaging Het
Pnpla1 T C 17: 28,876,863 F86S possibly damaging Het
Prlhr C T 19: 60,467,576 W184* probably null Het
Rtp3 A G 9: 110,987,136 S116P probably damaging Het
Sema3c T C 5: 17,681,986 I345T possibly damaging Het
Skor2 T C 18: 76,859,429 L282P unknown Het
Slc24a4 T C 12: 102,260,415 V468A probably damaging Het
Slfn8 C T 11: 83,003,334 M826I probably benign Het
Tacc2 A G 7: 130,729,120 D378G probably benign Het
Thbs3 C A 3: 89,220,163 D370E probably damaging Het
Tk1 CC GA 11: 117,817,122 probably benign Het
Tm7sf2 A G 19: 6,066,542 probably benign Het
Trappc8 T C 18: 20,874,680 Y126C probably damaging Het
Trim35 C G 14: 66,304,053 L209V possibly damaging Het
Trim35 T C 14: 66,304,054 L209P probably damaging Het
Trip12 C T 1: 84,730,458 probably benign Het
Trp53bp1 A G 2: 121,205,021 V1583A probably damaging Het
Tubgcp6 A T 15: 89,103,247 N1166K possibly damaging Het
Usp54 C T 14: 20,561,842 D969N probably benign Het
Vldlr C A 19: 27,243,771 S612R probably benign Het
Vps13a T C 19: 16,664,562 T2234A probably benign Het
Vps39 A G 2: 120,321,572 probably benign Het
Zdhhc3 A T 9: 123,091,081 C120S probably benign Het
Zfp37 A G 4: 62,191,234 F531S probably damaging Het
Other mutations in Hars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Hars2 APN 18 36785936 missense probably damaging 1.00
IGL00955:Hars2 APN 18 36789357 splice site probably benign
IGL01570:Hars2 APN 18 36787592 missense probably benign 0.04
IGL01618:Hars2 APN 18 36789577 nonsense probably null
IGL02165:Hars2 APN 18 36783394 start codon destroyed probably null 1.00
IGL02290:Hars2 APN 18 36785626 missense possibly damaging 0.56
IGL02685:Hars2 APN 18 36791118 missense probably benign 0.18
IGL02805:Hars2 APN 18 36787577 nonsense probably null
IGL02971:Hars2 APN 18 36786178 missense probably damaging 1.00
IGL03373:Hars2 APN 18 36785945 missense probably damaging 0.99
R0196:Hars2 UTSW 18 36789204 nonsense probably null
R0543:Hars2 UTSW 18 36789424 missense probably damaging 1.00
R0549:Hars2 UTSW 18 36786208 critical splice donor site probably null
R0557:Hars2 UTSW 18 36791077 missense possibly damaging 0.94
R0893:Hars2 UTSW 18 36787595 missense possibly damaging 0.56
R1188:Hars2 UTSW 18 36787969 missense probably damaging 0.99
R1289:Hars2 UTSW 18 36783412 splice site probably null
R1381:Hars2 UTSW 18 36789217 missense possibly damaging 0.68
R2401:Hars2 UTSW 18 36789523 missense possibly damaging 0.95
R4119:Hars2 UTSW 18 36790488 missense probably damaging 0.98
R4351:Hars2 UTSW 18 36786178 missense probably damaging 1.00
R4404:Hars2 UTSW 18 36785936 missense probably damaging 1.00
R5372:Hars2 UTSW 18 36790481 missense possibly damaging 0.93
R5629:Hars2 UTSW 18 36788666 nonsense probably null
R7069:Hars2 UTSW 18 36787956 missense probably damaging 0.99
R7070:Hars2 UTSW 18 36791112 nonsense probably null
R7188:Hars2 UTSW 18 36790561 missense probably benign 0.08
R7683:Hars2 UTSW 18 36788236 missense probably damaging 1.00
R7834:Hars2 UTSW 18 36789581 missense probably damaging 0.98
R7903:Hars2 UTSW 18 36786192 missense probably damaging 1.00
R8249:Hars2 UTSW 18 36788001 missense probably damaging 0.99
R8329:Hars2 UTSW 18 36789235 missense possibly damaging 0.94
R8362:Hars2 UTSW 18 36790175 missense probably benign
RF015:Hars2 UTSW 18 36785945 missense probably damaging 0.99
Z1177:Hars2 UTSW 18 36789575 missense probably damaging 1.00
Z1177:Hars2 UTSW 18 36790598 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCCTTTTGGAATTGCTACTGC -3'
(R):5'- GATCACTGTGCCGACATACAC -3'

Sequencing Primer
(F):5'- TGCATGCCTAGTACCAAAGGATGTC -3'
(R):5'- TGTGCCGACATACACCCAGATC -3'
Posted On2017-02-15