Mutagenetix > Incidental Mutations

Incidental Mutation 'R0557:Slc26a5'

45614

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

Pres, prestin

MMRRC Submission

038749-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0557 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21810655-21865604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21819764 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 441 (S441P)

Ref Sequence

ENSEMBL: ENSMUSP00000110830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030878
AA Change: S478P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: S478P

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115176
AA Change: S441P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: S441P

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127975
AA Change: S446P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: S446P

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142888
AA Change: S420P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: S420P

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150012

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	G	A	10: 79,067,685	H266Y	probably damaging	Het
Abi3bp	C	T	16: 56,668,387	R1294C	probably damaging	Het
Acot3	T	C	12: 84,058,856	Y366H	probably damaging	Het
Ago1	A	G	4: 126,460,024	V254A	probably benign	Het
Ahnak	T	A	19: 9,001,944	D197E	probably benign	Het
Aldh1b1	A	T	4: 45,802,647	T62S	probably benign	Het
Alox12e	T	C	11: 70,321,448	R135G	possibly damaging	Het
Amn1	T	C	6: 149,171,005	Y78C	possibly damaging	Het
Ankmy2	G	A	12: 36,187,766	S288N	probably benign	Het
Ano3	A	T	2: 110,862,952		probably null	Het
Arfgap3	T	C	15: 83,303,185	D491G	probably damaging	Het
Arhgap15	T	C	2: 44,116,617	S249P	possibly damaging	Het
Atp9b	A	G	18: 80,765,922	V211A	probably damaging	Het
Cabin1	A	G	10: 75,726,917	Y12H	probably damaging	Het
Cdkn2aip	T	C	8: 47,712,942	T110A	probably damaging	Het
Chchd6	A	G	6: 89,574,587	S31P	probably damaging	Het
Chrna3	A	G	9: 55,015,865	Y220H	probably damaging	Het
Ctu1	A	G	7: 43,677,159	D414G	unknown	Het
Cxxc1	C	T	18: 74,218,774	R241W	possibly damaging	Het
Cyp3a16	A	G	5: 145,469,588	I18T	unknown	Het
Dip2c	A	T	13: 9,553,459	I405F	possibly damaging	Het
Disp3	A	T	4: 148,241,404	M1299K	possibly damaging	Het
Dnah9	T	G	11: 66,084,666	H1519P	probably damaging	Het
Ehd3	C	A	17: 73,829,933	Q366K	probably benign	Het
Exosc3	A	T	4: 45,316,957	M232K	probably damaging	Het
Fam196a	A	G	7: 134,918,705	L32P	probably damaging	Het
Fancm	T	C	12: 65,118,442		probably null	Het
Fgfr2	A	G	7: 130,219,081	V241A	probably damaging	Het
Gdf2	C	T	14: 33,941,221	P24L	probably damaging	Het
Hars2	T	C	18: 36,791,077	I489T	possibly damaging	Het
Ice1	T	C	13: 70,601,191	I1945V	probably benign	Het
Il33	A	C	19: 29,954,636	N143T	probably damaging	Het
Ilvbl	G	A	10: 78,583,487	W313*	probably null	Het
Isca1	G	T	13: 59,756,974	Q91K	possibly damaging	Het
Kcnh5	T	A	12: 75,114,549	Y195F	probably damaging	Het
Lama4	T	G	10: 39,088,397	I1355S	probably benign	Het
Lonrf1	T	C	8: 36,230,420	D470G	probably benign	Het
Mak	A	G	13: 41,039,659	Y446H	probably benign	Het
Mki67	C	T	7: 135,699,261	S1348N	possibly damaging	Het
Mpzl3	A	G	9: 45,066,508	Y138C	probably damaging	Het
Myh8	T	C	11: 67,301,798	L1501P	possibly damaging	Het
Naa35	A	G	13: 59,627,964	E552G	probably damaging	Het
Ncor2	A	T	5: 125,106,305	L200*	probably null	Het
Nrm	T	C	17: 35,864,632	V210A	probably damaging	Het
Nt5e	T	A	9: 88,366,466	N405K	probably damaging	Het
Olfr108	T	A	17: 37,445,821	I100N	probably damaging	Het
Olfr350	T	A	2: 36,850,748	I234N	possibly damaging	Het
Orc2	T	C	1: 58,469,687	S434G	probably damaging	Het
Plcb4	G	A	2: 135,954,349	V388I	probably damaging	Het
Ppm1l	A	G	3: 69,497,901	D177G	probably benign	Het
Prl8a2	A	T	13: 27,352,892	R165*	probably null	Het
Ptbp3	G	A	4: 59,517,684	R66*	probably null	Het
Pten	A	G	19: 32,817,890	T286A	probably benign	Het
Rac2	C	T	15: 78,564,974	V113M	probably damaging	Het
Rai1	C	T	11: 60,190,495	T1795I	probably benign	Het
Ros1	T	G	10: 52,085,263	K1792Q	possibly damaging	Het
Sema6a	A	G	18: 47,249,500	V660A	probably benign	Het
Slc22a23	C	T	13: 34,344,383	G139S	possibly damaging	Het
Slc27a3	A	G	3: 90,386,856	L462P	probably damaging	Het
Spag5	T	A	11: 78,314,211	S607R	probably damaging	Het
Spata18	A	T	5: 73,651,670	N29Y	probably damaging	Het
Spata20	C	T	11: 94,485,222	R22H	probably benign	Het
Spsb2	A	C	6: 124,810,392	Y263S	probably damaging	Het
Sptbn4	C	A	7: 27,408,328	E885*	probably null	Het
Syne2	T	C	12: 75,929,301	I1175T	probably benign	Het
Tmem2	C	T	19: 21,811,903	A567V	probably benign	Het
Tmem209	A	C	6: 30,501,914	H253Q	probably damaging	Het
Trip12	A	T	1: 84,724,747	D788E	probably damaging	Het
Usp34	T	C	11: 23,403,848	S1509P	probably damaging	Het
Utp20	A	T	10: 88,748,311	D2661E	probably damaging	Het
Vars	C	A	17: 35,004,984	P264Q	possibly damaging	Het
Vmn2r66	T	G	7: 84,994,764	S813R	probably damaging	Het
Wipf2	C	A	11: 98,892,089	Q114K	possibly damaging	Het
Wnt5b	G	T	6: 119,433,818	H220Q	probably damaging	Het
Xirp2	A	G	2: 67,516,351	T2979A	probably benign	Het
Zfyve9	A	G	4: 108,674,511	V408A	probably damaging	Het
Zzef1	T	C	11: 72,917,730	S2744P	probably damaging	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	21815736	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	21846325	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	21819767	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	21813383	splice site	probably benign
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	21811344	splice site	probably null
R0136:Slc26a5	UTSW	5	21834347	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	21823549	nonsense	probably null
R0522:Slc26a5	UTSW	5	21846345	missense	probably damaging	0.96
R0711:Slc26a5	UTSW	5	21847232	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	21816961	missense	probably benign	0.01
R1214:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R1471:Slc26a5	UTSW	5	21816964	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1648:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1861:Slc26a5	UTSW	5	21816958	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	21815727	missense	probably benign	0.03
R2106:Slc26a5	UTSW	5	21823544	missense	probably damaging	1.00
R2169:Slc26a5	UTSW	5	21813865	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	21823478	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	21823547	missense	probably benign	0.39
R2281:Slc26a5	UTSW	5	21831510	missense	possibly damaging	0.94
R2325:Slc26a5	UTSW	5	21819694	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	21847191	missense	probably damaging	1.00
R4793:Slc26a5	UTSW	5	21837994	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	21820386	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	21847196	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	21813901	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	21847260	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	21816976	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	21823563	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	21821097	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	21820350	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	21819719	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	21834344	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	21840572	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	21811336	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	21816974	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	21813894	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	21837246	nonsense	probably null
R7650:Slc26a5	UTSW	5	21834330	missense	possibly damaging	0.96
R8431:Slc26a5	UTSW	5	21813906	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAAGCATGAGTCCTATCACGAGGC -3'
(R):5'- TGTTACTCAGGCAAGGATTGGGGAG -3'

Sequencing Primer
(F):5'- ATAGCCCTGATCGAGCACTATTTG -3'
(R):5'- GTGTGTTACTTAGGAGAAgtgtg -3'

Posted On

2013-06-11