Incidental Mutation 'R5887:Spocd1'
ID456158
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5887 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129948959 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 56 (S56C)
Ref Sequence ENSEMBL: ENSMUSP00000118383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect probably damaging
Transcript: ENSMUST00000084263
AA Change: S412C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: S412C

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128007
AA Change: S56C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784
AA Change: S56C

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,915,143 Q129* probably null Het
Acad8 A T 9: 26,979,324 probably null Het
AK157302 T C 13: 21,495,409 I35T possibly damaging Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Calcrl A T 2: 84,370,497 W68R probably damaging Het
Cd59a A G 2: 104,104,201 R5G probably damaging Het
Chl1 C T 6: 103,717,604 A1091V probably benign Het
Copg1 T C 6: 87,902,297 F442L probably damaging Het
Creld1 T C 6: 113,492,899 *421Q probably null Het
Crocc2 T A 1: 93,194,116 H662Q possibly damaging Het
Csf2ra G A 19: 61,227,328 A13V possibly damaging Het
Cul3 T C 1: 80,276,422 T546A possibly damaging Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Dock6 T A 9: 21,820,394 H1173L probably damaging Het
Dpysl4 T C 7: 139,096,276 I328T possibly damaging Het
Dspp G A 5: 104,175,455 G155R probably damaging Het
Fam208a T A 14: 27,466,297 L900* probably null Het
Fbxo33 A T 12: 59,204,759 C57* probably null Het
Frrs1 T A 3: 116,896,750 V14D probably benign Het
Gm13199 C T 2: 5,862,302 G96S unknown Het
Gm609 T A 16: 45,417,916 L178F probably damaging Het
Gpr155 A T 2: 73,343,718 C754* probably null Het
Gpr62 A T 9: 106,465,615 V38E probably damaging Het
Kcnt2 C A 1: 140,425,366 P271H probably damaging Het
Kpna3 C T 14: 61,403,012 V34I probably benign Het
Lamb1 C T 12: 31,266,864 Q71* probably null Het
Lipk T C 19: 34,039,107 I245T possibly damaging Het
Lrp1b T G 2: 40,821,707 N3281T possibly damaging Het
Lrp5 A C 19: 3,604,094 I1111S probably benign Het
Mmrn1 T C 6: 60,987,074 V1020A probably benign Het
Olfr1212 G A 2: 88,958,754 C96Y possibly damaging Het
Olfr912 G A 9: 38,581,784 C169Y probably damaging Het
Olfr954 T C 9: 39,461,491 L17P probably damaging Het
Pcdha7 A T 18: 36,975,907 T662S probably damaging Het
Pcdhga6 A G 18: 37,708,559 D444G probably damaging Het
Pkd2 T G 5: 104,498,539 D737E probably damaging Het
Plcd4 C T 1: 74,551,090 R161W probably damaging Het
Prpf8 A G 11: 75,500,908 Y1494C possibly damaging Het
Rad17 A C 13: 100,633,861 probably null Het
Rbm17 A T 2: 11,585,674 F390Y probably damaging Het
Rhod A T 19: 4,439,287 L22Q probably damaging Het
Serpina1f T C 12: 103,689,787 D394G possibly damaging Het
Serpina1f G A 12: 103,693,631 Q131* probably null Het
St7l G A 3: 104,874,928 R207H probably benign Het
Tbx18 T C 9: 87,713,513 D336G possibly damaging Het
Tfg A T 16: 56,694,416 Y135* probably null Het
Tjp2 A G 19: 24,096,599 L1108P probably benign Het
Tmem150c C A 5: 100,095,665 V8L probably benign Het
Ttn A T 2: 76,916,445 H4753Q probably benign Het
Tyw1 T A 5: 130,325,699 I589N probably damaging Het
Usp40 C T 1: 87,999,870 R139Q probably damaging Het
Zgrf1 A G 3: 127,584,765 Y174C probably damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129948870 missense possibly damaging 0.93
R1128:Spocd1 UTSW 4 129956806 missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129951786 missense probably benign 0.04
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R6185:Spocd1 UTSW 4 129956449 missense probably benign 0.02
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7090:Spocd1 UTSW 4 129953898 missense
R7548:Spocd1 UTSW 4 129929809 missense
R7570:Spocd1 UTSW 4 129930164 missense
Predicted Primers PCR Primer
(F):5'- CCATCCAAGAAAGGAGATGGCC -3'
(R):5'- ACCAGGTTGTTAGGGGTGAC -3'

Sequencing Primer
(F):5'- GCCTCCCTCTCAGAATAAGTGAGG -3'
(R):5'- ACCTTCAGTCTGTTCCTAGT -3'
Posted On2017-02-15