Incidental Mutation 'R5887:Dock6'
ID456170
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R5887 (G1)
Quality Score166
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21820394 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1173 (H1173L)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: H1173L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: H1173L

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215729
Predicted Effect probably benign
Transcript: ENSMUST00000216626
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: H1204L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,915,143 Q129* probably null Het
Acad8 A T 9: 26,979,324 probably null Het
AK157302 T C 13: 21,495,409 I35T possibly damaging Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Calcrl A T 2: 84,370,497 W68R probably damaging Het
Cd59a A G 2: 104,104,201 R5G probably damaging Het
Chl1 C T 6: 103,717,604 A1091V probably benign Het
Copg1 T C 6: 87,902,297 F442L probably damaging Het
Creld1 T C 6: 113,492,899 *421Q probably null Het
Crocc2 T A 1: 93,194,116 H662Q possibly damaging Het
Csf2ra G A 19: 61,227,328 A13V possibly damaging Het
Cul3 T C 1: 80,276,422 T546A possibly damaging Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Dpysl4 T C 7: 139,096,276 I328T possibly damaging Het
Dspp G A 5: 104,175,455 G155R probably damaging Het
Fam208a T A 14: 27,466,297 L900* probably null Het
Fbxo33 A T 12: 59,204,759 C57* probably null Het
Frrs1 T A 3: 116,896,750 V14D probably benign Het
Gm13199 C T 2: 5,862,302 G96S unknown Het
Gm609 T A 16: 45,417,916 L178F probably damaging Het
Gpr155 A T 2: 73,343,718 C754* probably null Het
Gpr62 A T 9: 106,465,615 V38E probably damaging Het
Kcnt2 C A 1: 140,425,366 P271H probably damaging Het
Kpna3 C T 14: 61,403,012 V34I probably benign Het
Lamb1 C T 12: 31,266,864 Q71* probably null Het
Lipk T C 19: 34,039,107 I245T possibly damaging Het
Lrp1b T G 2: 40,821,707 N3281T possibly damaging Het
Lrp5 A C 19: 3,604,094 I1111S probably benign Het
Mmrn1 T C 6: 60,987,074 V1020A probably benign Het
Olfr1212 G A 2: 88,958,754 C96Y possibly damaging Het
Olfr912 G A 9: 38,581,784 C169Y probably damaging Het
Olfr954 T C 9: 39,461,491 L17P probably damaging Het
Pcdha7 A T 18: 36,975,907 T662S probably damaging Het
Pcdhga6 A G 18: 37,708,559 D444G probably damaging Het
Pkd2 T G 5: 104,498,539 D737E probably damaging Het
Plcd4 C T 1: 74,551,090 R161W probably damaging Het
Prpf8 A G 11: 75,500,908 Y1494C possibly damaging Het
Rad17 A C 13: 100,633,861 probably null Het
Rbm17 A T 2: 11,585,674 F390Y probably damaging Het
Rhod A T 19: 4,439,287 L22Q probably damaging Het
Serpina1f T C 12: 103,689,787 D394G possibly damaging Het
Serpina1f G A 12: 103,693,631 Q131* probably null Het
Spocd1 A T 4: 129,948,959 S56C probably damaging Het
St7l G A 3: 104,874,928 R207H probably benign Het
Tbx18 T C 9: 87,713,513 D336G possibly damaging Het
Tfg A T 16: 56,694,416 Y135* probably null Het
Tjp2 A G 19: 24,096,599 L1108P probably benign Het
Tmem150c C A 5: 100,095,665 V8L probably benign Het
Ttn A T 2: 76,916,445 H4753Q probably benign Het
Tyw1 T A 5: 130,325,699 I589N probably damaging Het
Usp40 C T 1: 87,999,870 R139Q probably damaging Het
Zgrf1 A G 3: 127,584,765 Y174C probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TAGACACTGTGGTGAGTCTGGC -3'
(R):5'- CGAAGGTGACCAGCATGTTC -3'

Sequencing Primer
(F):5'- TGAGTCTGGCCCAAGCTG -3'
(R):5'- TGACCAGCATGTTCGAGCTGAG -3'
Posted On2017-02-15