Incidental Mutation 'R5887:Olfr954'
ID456173
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Nameolfactory receptor 954
SynonymsGA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5887 (G1)
Quality Score223
Status Not validated
Chromosome9
Chromosomal Location39456701-39464625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39461491 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 17 (L17P)
Ref Sequence ENSEMBL: ENSMUSP00000151116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
Predicted Effect probably damaging
Transcript: ENSMUST00000080329
AA Change: L20P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: L20P

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214818
AA Change: L17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,915,143 Q129* probably null Het
Acad8 A T 9: 26,979,324 probably null Het
AK157302 T C 13: 21,495,409 I35T possibly damaging Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Calcrl A T 2: 84,370,497 W68R probably damaging Het
Cd59a A G 2: 104,104,201 R5G probably damaging Het
Chl1 C T 6: 103,717,604 A1091V probably benign Het
Copg1 T C 6: 87,902,297 F442L probably damaging Het
Creld1 T C 6: 113,492,899 *421Q probably null Het
Crocc2 T A 1: 93,194,116 H662Q possibly damaging Het
Csf2ra G A 19: 61,227,328 A13V possibly damaging Het
Cul3 T C 1: 80,276,422 T546A possibly damaging Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Dock6 T A 9: 21,820,394 H1173L probably damaging Het
Dpysl4 T C 7: 139,096,276 I328T possibly damaging Het
Dspp G A 5: 104,175,455 G155R probably damaging Het
Fam208a T A 14: 27,466,297 L900* probably null Het
Fbxo33 A T 12: 59,204,759 C57* probably null Het
Frrs1 T A 3: 116,896,750 V14D probably benign Het
Gm13199 C T 2: 5,862,302 G96S unknown Het
Gm609 T A 16: 45,417,916 L178F probably damaging Het
Gpr155 A T 2: 73,343,718 C754* probably null Het
Gpr62 A T 9: 106,465,615 V38E probably damaging Het
Kcnt2 C A 1: 140,425,366 P271H probably damaging Het
Kpna3 C T 14: 61,403,012 V34I probably benign Het
Lamb1 C T 12: 31,266,864 Q71* probably null Het
Lipk T C 19: 34,039,107 I245T possibly damaging Het
Lrp1b T G 2: 40,821,707 N3281T possibly damaging Het
Lrp5 A C 19: 3,604,094 I1111S probably benign Het
Mmrn1 T C 6: 60,987,074 V1020A probably benign Het
Olfr1212 G A 2: 88,958,754 C96Y possibly damaging Het
Olfr912 G A 9: 38,581,784 C169Y probably damaging Het
Pcdha7 A T 18: 36,975,907 T662S probably damaging Het
Pcdhga6 A G 18: 37,708,559 D444G probably damaging Het
Pkd2 T G 5: 104,498,539 D737E probably damaging Het
Plcd4 C T 1: 74,551,090 R161W probably damaging Het
Prpf8 A G 11: 75,500,908 Y1494C possibly damaging Het
Rad17 A C 13: 100,633,861 probably null Het
Rbm17 A T 2: 11,585,674 F390Y probably damaging Het
Rhod A T 19: 4,439,287 L22Q probably damaging Het
Serpina1f T C 12: 103,689,787 D394G possibly damaging Het
Serpina1f G A 12: 103,693,631 Q131* probably null Het
Spocd1 A T 4: 129,948,959 S56C probably damaging Het
St7l G A 3: 104,874,928 R207H probably benign Het
Tbx18 T C 9: 87,713,513 D336G possibly damaging Het
Tfg A T 16: 56,694,416 Y135* probably null Het
Tjp2 A G 19: 24,096,599 L1108P probably benign Het
Tmem150c C A 5: 100,095,665 V8L probably benign Het
Ttn A T 2: 76,916,445 H4753Q probably benign Het
Tyw1 T A 5: 130,325,699 I589N probably damaging Het
Usp40 C T 1: 87,999,870 R139Q probably damaging Het
Zgrf1 A G 3: 127,584,765 Y174C probably damaging Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0041:Olfr954 UTSW 9 39461476 missense probably benign 0.34
R0153:Olfr954 UTSW 9 39461671 missense probably damaging 0.99
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3081:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4786:Olfr954 UTSW 9 39461841 missense probably benign 0.16
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5602:Olfr954 UTSW 9 39462030 missense probably benign 0.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
R7567:Olfr954 UTSW 9 39461877 missense possibly damaging 0.92
R8817:Olfr954 UTSW 9 39462091 missense probably damaging 1.00
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Z1177:Olfr954 UTSW 9 39461701 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACTTTCACTCGCTAATACAGAC -3'
(R):5'- GGTAACAACTGTGGACTGACC -3'

Sequencing Primer
(F):5'- TTGAGACTTTGCAATGAAAGGATG -3'
(R):5'- CAAAGTCAATGAAGGACAAACTGCTG -3'
Posted On2017-02-15