Incidental Mutation 'R5889:Hspa5'
ID456198
Institutional Source Beutler Lab
Gene Symbol Hspa5
Ensembl Gene ENSMUSG00000026864
Gene Nameheat shock protein 5
SynonymsBip, 78kDa, Sez7, Grp78, D2Wsu141e, D2Wsu17e, Hsce70, XAP-1 antigen, mBiP, baffled
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34771970-34777547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34774617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 361 (V361A)
Ref Sequence ENSEMBL: ENSMUSP00000097747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028222] [ENSMUST00000100171] [ENSMUST00000113086] [ENSMUST00000118108] [ENSMUST00000137145] [ENSMUST00000145903]
Predicted Effect probably damaging
Transcript: ENSMUST00000028222
AA Change: V361A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028222
Gene: ENSMUSG00000026864
AA Change: V361A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 8.2e-276 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047963
SMART Domains Protein: ENSMUSP00000037746
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 5 51 6.7e-13 PFAM
Pfam:Kelch_4 5 58 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100171
AA Change: V361A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097747
Gene: ENSMUSG00000026864
AA Change: V361A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 3.3e-278 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113086
SMART Domains Protein: ENSMUSP00000108709
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 5e-15 PFAM
Pfam:Kelch_4 30 86 6.7e-10 PFAM
Pfam:Kelch_3 47 96 1e-12 PFAM
Pfam:Kelch_4 87 140 4.6e-7 PFAM
Pfam:Kelch_3 98 150 1.6e-9 PFAM
Pfam:Kelch_5 138 174 6.2e-8 PFAM
Pfam:Kelch_1 141 186 8.3e-7 PFAM
Pfam:Kelch_4 141 190 2.3e-10 PFAM
Pfam:Kelch_6 141 190 4.1e-10 PFAM
Pfam:Kelch_3 151 200 3.5e-8 PFAM
Pfam:Kelch_5 188 225 1.8e-7 PFAM
Pfam:Kelch_1 191 233 2.8e-9 PFAM
Pfam:Kelch_4 193 240 9.4e-9 PFAM
Pfam:Kelch_3 201 250 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118108
SMART Domains Protein: ENSMUSP00000113099
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 2.8e-16 PFAM
Pfam:Kelch_4 30 82 3.7e-6 PFAM
Pfam:Kelch_3 99 147 8.2e-9 PFAM
Pfam:Kelch_4 138 191 2.7e-6 PFAM
Pfam:Kelch_3 149 201 7.9e-9 PFAM
Pfam:Kelch_5 189 225 2.8e-7 PFAM
Pfam:Kelch_1 192 237 5.2e-6 PFAM
Pfam:Kelch_4 192 241 1.3e-9 PFAM
Pfam:Kelch_6 192 241 2.4e-9 PFAM
Pfam:Kelch_3 202 251 1.7e-7 PFAM
Pfam:Kelch_5 239 276 8.1e-7 PFAM
Pfam:Kelch_1 242 284 1.8e-8 PFAM
Pfam:Kelch_4 244 291 5.5e-8 PFAM
Pfam:Kelch_3 252 301 3.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129333
Predicted Effect probably benign
Transcript: ENSMUST00000137145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145466
Predicted Effect probably benign
Transcript: ENSMUST00000145903
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155595
Meta Mutation Damage Score 0.8345 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
PHENOTYPE: Nullizygous embryos die around implantation. Neonates homozygous for a knock-in allele die of respiratory failure. Mice homozygous for an ENU-induced mutation exhibit abnormal thalamocortical axon patterning, small kidneys, cleft palate, respiratory distress, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Hspa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Hspa5 APN 2 34774718 missense probably benign
IGL01997:Hspa5 APN 2 34772315 utr 5 prime probably benign
IGL02239:Hspa5 APN 2 34772776 missense probably benign 0.00
IGL03326:Hspa5 APN 2 34776117 unclassified probably benign
R0281:Hspa5 UTSW 2 34774320 missense probably damaging 1.00
R1052:Hspa5 UTSW 2 34775098 missense probably damaging 0.99
R1687:Hspa5 UTSW 2 34775824 missense probably benign 0.00
R1741:Hspa5 UTSW 2 34772692 missense possibly damaging 0.91
R1833:Hspa5 UTSW 2 34776053 nonsense probably null
R1842:Hspa5 UTSW 2 34775803 missense probably damaging 1.00
R1851:Hspa5 UTSW 2 34774678 missense possibly damaging 0.64
R1864:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R1865:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R2173:Hspa5 UTSW 2 34774662 missense probably damaging 1.00
R5027:Hspa5 UTSW 2 34775815 missense probably damaging 1.00
R6046:Hspa5 UTSW 2 34775749 missense possibly damaging 0.94
R6515:Hspa5 UTSW 2 34772404 missense probably benign 0.05
R7045:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7046:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7047:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7049:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7185:Hspa5 UTSW 2 34775126 missense probably damaging 1.00
R7238:Hspa5 UTSW 2 34772371 missense unknown
X0067:Hspa5 UTSW 2 34775101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCTAATGGAATCCGC -3'
(R):5'- GTTTCCTAAAGCAACAGTCCTC -3'

Sequencing Primer
(F):5'- CAGTGCTAATGGAATCCGCTTAGAC -3'
(R):5'- GTCCTCCCATCGAGCTACTTAAACAG -3'
Posted On2017-02-15