Incidental Mutation 'R5889:Ssfa2'
ID456201
Institutional Source Beutler Lab
Gene Symbol Ssfa2
Ensembl Gene ENSMUSG00000027007
Gene Namesperm specific antigen 2
SynonymsCS1, CS-1, SPAG13, KRAP
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79635352-79672966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79657728 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 718 (D718E)
Ref Sequence ENSEMBL: ENSMUSP00000107415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
Predicted Effect probably damaging
Transcript: ENSMUST00000111784
AA Change: D718E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: D718E

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111785
AA Change: D718E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: D718E

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111788
AA Change: D718E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: D718E

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133266
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Ssfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ssfa2 APN 2 79657268 missense possibly damaging 0.94
IGL00792:Ssfa2 APN 2 79657463 missense probably benign 0.01
IGL00900:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL00902:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL01682:Ssfa2 APN 2 79635637 missense probably damaging 1.00
IGL01683:Ssfa2 APN 2 79670725 intron probably benign
IGL01832:Ssfa2 APN 2 79651418 missense possibly damaging 0.94
IGL02253:Ssfa2 APN 2 79660444 missense probably damaging 1.00
IGL02342:Ssfa2 APN 2 79660285 missense probably benign 0.01
IGL02420:Ssfa2 APN 2 79635642 missense probably damaging 0.99
IGL02445:Ssfa2 APN 2 79657498 missense probably damaging 0.98
IGL02649:Ssfa2 APN 2 79641959 splice site probably benign
IGL03242:Ssfa2 APN 2 79643471 nonsense probably null
IGL03266:Ssfa2 APN 2 79642190 critical splice donor site probably null
IGL03342:Ssfa2 APN 2 79660452 missense probably damaging 1.00
IGL03352:Ssfa2 APN 2 79645101 missense probably damaging 1.00
R0255:Ssfa2 UTSW 2 79660466 missense probably damaging 1.00
R0526:Ssfa2 UTSW 2 79657346 missense probably benign 0.01
R0543:Ssfa2 UTSW 2 79644506 missense possibly damaging 0.79
R1114:Ssfa2 UTSW 2 79657529 missense probably damaging 1.00
R1701:Ssfa2 UTSW 2 79636050 missense probably damaging 1.00
R1734:Ssfa2 UTSW 2 79657822 missense probably damaging 1.00
R1945:Ssfa2 UTSW 2 79662652 missense probably benign 0.03
R2188:Ssfa2 UTSW 2 79644923 missense probably benign 0.01
R2941:Ssfa2 UTSW 2 79635656 missense probably benign 0.19
R4087:Ssfa2 UTSW 2 79658347 nonsense probably null
R4107:Ssfa2 UTSW 2 79644831 missense probably damaging 0.97
R4355:Ssfa2 UTSW 2 79641998 missense probably benign 0.02
R4497:Ssfa2 UTSW 2 79657820 missense probably damaging 1.00
R4615:Ssfa2 UTSW 2 79662382 missense probably damaging 0.99
R4726:Ssfa2 UTSW 2 79662757 missense probably damaging 1.00
R5818:Ssfa2 UTSW 2 79644593 missense probably damaging 1.00
R6169:Ssfa2 UTSW 2 79645062 missense probably damaging 0.99
R6337:Ssfa2 UTSW 2 79655119 missense probably damaging 1.00
R6677:Ssfa2 UTSW 2 79655101 missense possibly damaging 0.92
R6709:Ssfa2 UTSW 2 79644932 missense probably benign 0.00
R6855:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R6856:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R7075:Ssfa2 UTSW 2 79635660 missense probably damaging 0.99
R7319:Ssfa2 UTSW 2 79636072 missense probably damaging 1.00
R7414:Ssfa2 UTSW 2 79644728 missense possibly damaging 0.95
R7590:Ssfa2 UTSW 2 79658110 missense possibly damaging 0.88
R7722:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAATTTGCCCAGTACACCAC -3'
(R):5'- GACCATCGTGTTCAGTTCCTTG -3'

Sequencing Primer
(F):5'- ACACACCATATTCTCAGATCCTTGG -3'
(R):5'- CAGGTCTTGTTCCTCTTCGGG -3'
Posted On2017-02-15