Incidental Mutation 'R5889:Gabra4'
ID456217
Institutional Source Beutler Lab
Gene Symbol Gabra4
Ensembl Gene ENSMUSG00000029211
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
SynonymsGabra-4
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location71569749-71658308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71571891 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 515 (N515K)
Ref Sequence ENSEMBL: ENSMUSP00000143675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031121] [ENSMUST00000197994] [ENSMUST00000198138] [ENSMUST00000199357]
Predicted Effect probably benign
Transcript: ENSMUST00000031121
AA Change: N489K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031121
Gene: ENSMUSG00000029211
AA Change: N489K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 256 8.8e-52 PFAM
Pfam:Neur_chan_memb 263 536 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197994
Predicted Effect probably benign
Transcript: ENSMUST00000198138
SMART Domains Protein: ENSMUSP00000142466
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 53 69 3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199357
AA Change: N515K

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143675
Gene: ENSMUSG00000029211
AA Change: N515K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 91 282 1.7e-45 PFAM
Pfam:Neur_chan_memb 289 562 3.3e-44 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Gabra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Gabra4 APN 5 71633629 missense probably damaging 1.00
IGL01503:Gabra4 APN 5 71641086 missense possibly damaging 0.60
IGL02028:Gabra4 APN 5 71633596 missense probably damaging 1.00
IGL02688:Gabra4 APN 5 71572167 missense probably benign
IGL02749:Gabra4 APN 5 71638147 missense probably benign 0.42
IGL03095:Gabra4 APN 5 71624015 missense probably damaging 1.00
IGL03330:Gabra4 APN 5 71641064 missense probably null 1.00
E0354:Gabra4 UTSW 5 71640861 missense probably damaging 1.00
PIT4142001:Gabra4 UTSW 5 71571763 missense probably damaging 1.00
R1523:Gabra4 UTSW 5 71633632 missense probably damaging 1.00
R1622:Gabra4 UTSW 5 71571986 missense possibly damaging 0.57
R1689:Gabra4 UTSW 5 71633542 splice site probably null
R1930:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1931:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1967:Gabra4 UTSW 5 71572069 missense possibly damaging 0.87
R2095:Gabra4 UTSW 5 71624112 missense probably damaging 0.99
R2131:Gabra4 UTSW 5 71641224 missense probably benign 0.00
R2698:Gabra4 UTSW 5 71572078 missense probably benign 0.03
R3884:Gabra4 UTSW 5 71657257 missense probably benign 0.33
R3924:Gabra4 UTSW 5 71642253 splice site probably benign
R4029:Gabra4 UTSW 5 71572189 missense probably benign 0.31
R4361:Gabra4 UTSW 5 71633545 critical splice donor site probably null
R4659:Gabra4 UTSW 5 71641144 missense probably damaging 1.00
R4682:Gabra4 UTSW 5 71657809 start codon destroyed probably null 0.74
R4810:Gabra4 UTSW 5 71623982 missense probably damaging 1.00
R4888:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5093:Gabra4 UTSW 5 71640864 missense probably damaging 1.00
R5121:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5906:Gabra4 UTSW 5 71623910 missense probably benign 0.00
R6574:Gabra4 UTSW 5 71623925 missense probably benign
R7068:Gabra4 UTSW 5 71572059 missense probably benign 0.07
R7571:Gabra4 UTSW 5 71571992 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGTCTGTATTTCCATCGTTG -3'
(R):5'- CCATTCAGCAGGGCAAATGC -3'

Sequencing Primer
(F):5'- AGACTTTCTGATTTCTCCATGGTG -3'
(R):5'- CAAATGCAGCTGAGACTATGTCTGC -3'
Posted On2017-02-15