Mutagenetix > Incidental Mutation

Incidental Mutation 'R5889:Samd9l'

456219

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

044090-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3376460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 267 (Y267C)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000120087
AA Change: Y267C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: Y267C

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Meta Mutation Damage Score

0.1313

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,449	E297G	probably damaging	Het
Astn1	C	T	1: 158,600,380	P707L	possibly damaging	Het
Cep290	T	C	10: 100,499,074	S319P	possibly damaging	Het
Chrna4	A	C	2: 181,028,658	L435W	probably damaging	Het
Cilp	C	A	9: 65,280,343	A1240D	possibly damaging	Het
Col17a1	A	G	19: 47,649,072	F1249S	possibly damaging	Het
Creb3l3	T	C	10: 81,092,533		probably benign	Het
Cyp4f40	C	A	17: 32,675,757	T432N	probably benign	Het
Dsg1c	T	G	18: 20,283,601	I853R	possibly damaging	Het
Ebna1bp2	T	A	4: 118,621,423	D34E	probably damaging	Het
Edc4	C	T	8: 105,888,022	T112I	possibly damaging	Het
Enpep	T	A	3: 129,312,578	Y333F	probably damaging	Het
Exoc6	A	G	19: 37,582,245	H291R	probably damaging	Het
Fbln5	G	T	12: 101,765,226	N236K	probably damaging	Het
Fndc8	A	T	11: 82,898,729	T238S	probably damaging	Het
Frem3	T	C	8: 80,614,288	V1070A	probably damaging	Het
Gabra4	A	T	5: 71,571,891	N515K	possibly damaging	Het
Gemin5	A	G	11: 58,122,355	V1422A	possibly damaging	Het
Gm10118	A	G	10: 63,927,111		probably benign	Het
Grm5	A	G	7: 87,603,073	D177G	probably damaging	Het
Gtf2h4	G	A	17: 35,670,900	P147L	possibly damaging	Het
Hgsnat	T	C	8: 25,963,367	D265G	probably damaging	Het
Hsd17b4	T	A	18: 50,177,209	L513Q	probably damaging	Het
Hsd17b7	A	T	1: 169,955,918	M307K	probably benign	Het
Hspa5	T	C	2: 34,774,617	V361A	probably damaging	Het
Iqgap2	A	G	13: 95,632,042	V1450A	probably benign	Het
Itpr3	A	G	17: 27,115,065	E2037G	probably damaging	Het
Lama5	T	C	2: 180,193,674		probably benign	Het
Manba	G	T	3: 135,524,598	G311*	probably null	Het
Mettl24	T	A	10: 40,746,490	V236E	probably benign	Het
Myh3	A	G	11: 67,086,375	D310G	probably damaging	Het
Ncoa4	A	T	14: 32,166,659		probably benign	Het
Nop56	G	T	2: 130,275,982	R126L	probably damaging	Het
Nos3	C	A	5: 24,368,777		probably benign	Het
Olfr156	T	C	4: 43,820,492	M290V	possibly damaging	Het
Pcdhga3	T	A	18: 37,676,609	V705D	probably damaging	Het
Prom2	C	T	2: 127,529,411	A776T	possibly damaging	Het
Prss48	A	G	3: 85,998,185	I127T	probably damaging	Het
Rtca	T	C	3: 116,499,583	Y193C	possibly damaging	Het
Scube3	A	G	17: 28,160,913	R272G	possibly damaging	Het
Sprr1a	G	T	3: 92,484,644	H17N	probably benign	Het
Ssfa2	T	A	2: 79,657,728	D718E	probably damaging	Het
Stard3	G	C	11: 98,375,535	Q120H	probably benign	Het
Supt6	A	G	11: 78,212,748	I1377T	probably damaging	Het
Svop	A	T	5: 114,065,631	S30T	probably benign	Het
Syne2	T	A	12: 76,072,252	L5882*	probably null	Het
Tanc2	G	T	11: 105,921,807	R1359L	probably benign	Het
Tmc7	A	C	7: 118,566,326	L55R	probably benign	Het
Trappc11	G	A	8: 47,519,578	A320V	probably benign	Het
Ttll8	G	C	15: 88,933,939	P178A	probably damaging	Het
Ttn	T	C	2: 76,730,649	E20809G	probably damaging	Het
Tubb2a	A	T	13: 34,075,468	V113E	possibly damaging	Het
Ube2d1	A	T	10: 71,259,869		probably benign	Het
Usp48	T	C	4: 137,616,412	V452A	probably benign	Het
Vldlr	T	A	19: 27,239,664	I39N	probably damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Zyg11b	C	T	4: 108,237,380	W669*	probably null	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTGCTACTTTGCATCATAATG -3'
(R):5'- AGACAGGGCCACTCAATCTC -3'

Sequencing Primer
(F):5'- TGCAAAAGGACTTCCACG -3'
(R):5'- GGGCCACTCAATCTCATTGAC -3'

Posted On

2017-02-15