Mutagenetix > Incidental Mutation

Incidental Mutation 'R5889:Grm5'

456220

Institutional Source

Beutler Lab

Gene Symbol

Grm5

Ensembl Gene

ENSMUSG00000049583

Gene Name

glutamate receptor, metabotropic 5

Synonyms

Glu5R, mGluR5, 6430542K11Rik, Gprc1e

MMRRC Submission

044090-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R5889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87584168-88134907 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87603073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 177 (D177G)

Ref Sequence

ENSEMBL: ENSMUSP00000114927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]

AlphaFold

Q3UVX5

Predicted Effect

probably damaging
Transcript: ENSMUST00000107263
AA Change: D177G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: D177G

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.4e-97	PFAM
Pfam:Peripla_BP_6	130	332	2.5e-14	PFAM
Pfam:NCD3G	506	557	4.5e-20	PFAM
Pfam:7tm_3	588	824	7.4e-75	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125009
AA Change: D177G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: D177G

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.7e-101	PFAM
Pfam:Peripla_BP_6	129	327	5.4e-12	PFAM
Pfam:NCD3G	506	557	3.2e-16	PFAM
Pfam:7tm_3	590	823	3.5e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138732

Predicted Effect

probably damaging
Transcript: ENSMUST00000155358
AA Change: D177G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: D177G

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167164
AA Change: D177G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: D177G

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208791

Meta Mutation Damage Score

0.1841

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,449	E297G	probably damaging	Het
Astn1	C	T	1: 158,600,380	P707L	possibly damaging	Het
Cep290	T	C	10: 100,499,074	S319P	possibly damaging	Het
Chrna4	A	C	2: 181,028,658	L435W	probably damaging	Het
Cilp	C	A	9: 65,280,343	A1240D	possibly damaging	Het
Col17a1	A	G	19: 47,649,072	F1249S	possibly damaging	Het
Creb3l3	T	C	10: 81,092,533		probably benign	Het
Cyp4f40	C	A	17: 32,675,757	T432N	probably benign	Het
Dsg1c	T	G	18: 20,283,601	I853R	possibly damaging	Het
Ebna1bp2	T	A	4: 118,621,423	D34E	probably damaging	Het
Edc4	C	T	8: 105,888,022	T112I	possibly damaging	Het
Enpep	T	A	3: 129,312,578	Y333F	probably damaging	Het
Exoc6	A	G	19: 37,582,245	H291R	probably damaging	Het
Fbln5	G	T	12: 101,765,226	N236K	probably damaging	Het
Fndc8	A	T	11: 82,898,729	T238S	probably damaging	Het
Frem3	T	C	8: 80,614,288	V1070A	probably damaging	Het
Gabra4	A	T	5: 71,571,891	N515K	possibly damaging	Het
Gemin5	A	G	11: 58,122,355	V1422A	possibly damaging	Het
Gm10118	A	G	10: 63,927,111		probably benign	Het
Gtf2h4	G	A	17: 35,670,900	P147L	possibly damaging	Het
Hgsnat	T	C	8: 25,963,367	D265G	probably damaging	Het
Hsd17b4	T	A	18: 50,177,209	L513Q	probably damaging	Het
Hsd17b7	A	T	1: 169,955,918	M307K	probably benign	Het
Hspa5	T	C	2: 34,774,617	V361A	probably damaging	Het
Iqgap2	A	G	13: 95,632,042	V1450A	probably benign	Het
Itpr3	A	G	17: 27,115,065	E2037G	probably damaging	Het
Lama5	T	C	2: 180,193,674		probably benign	Het
Manba	G	T	3: 135,524,598	G311*	probably null	Het
Mettl24	T	A	10: 40,746,490	V236E	probably benign	Het
Myh3	A	G	11: 67,086,375	D310G	probably damaging	Het
Ncoa4	A	T	14: 32,166,659		probably benign	Het
Nop56	G	T	2: 130,275,982	R126L	probably damaging	Het
Nos3	C	A	5: 24,368,777		probably benign	Het
Olfr156	T	C	4: 43,820,492	M290V	possibly damaging	Het
Pcdhga3	T	A	18: 37,676,609	V705D	probably damaging	Het
Prom2	C	T	2: 127,529,411	A776T	possibly damaging	Het
Prss48	A	G	3: 85,998,185	I127T	probably damaging	Het
Rtca	T	C	3: 116,499,583	Y193C	possibly damaging	Het
Samd9l	T	C	6: 3,376,460	Y267C	probably damaging	Het
Scube3	A	G	17: 28,160,913	R272G	possibly damaging	Het
Sprr1a	G	T	3: 92,484,644	H17N	probably benign	Het
Ssfa2	T	A	2: 79,657,728	D718E	probably damaging	Het
Stard3	G	C	11: 98,375,535	Q120H	probably benign	Het
Supt6	A	G	11: 78,212,748	I1377T	probably damaging	Het
Svop	A	T	5: 114,065,631	S30T	probably benign	Het
Syne2	T	A	12: 76,072,252	L5882*	probably null	Het
Tanc2	G	T	11: 105,921,807	R1359L	probably benign	Het
Tmc7	A	C	7: 118,566,326	L55R	probably benign	Het
Trappc11	G	A	8: 47,519,578	A320V	probably benign	Het
Ttll8	G	C	15: 88,933,939	P178A	probably damaging	Het
Ttn	T	C	2: 76,730,649	E20809G	probably damaging	Het
Tubb2a	A	T	13: 34,075,468	V113E	possibly damaging	Het
Ube2d1	A	T	10: 71,259,869		probably benign	Het
Usp48	T	C	4: 137,616,412	V452A	probably benign	Het
Vldlr	T	A	19: 27,239,664	I39N	probably damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Zyg11b	C	T	4: 108,237,380	W669*	probably null	Het

Other mutations in Grm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Grm5	APN	7	88130781	missense	probably benign	0.00
IGL00970:Grm5	APN	7	87803896	missense	probably damaging	0.97
IGL01286:Grm5	APN	7	87602565	missense	probably benign	0.00
IGL01307:Grm5	APN	7	88075012	missense	probably damaging	1.00
IGL01603:Grm5	APN	7	87603178	missense	probably damaging	1.00
IGL01646:Grm5	APN	7	88040059	missense	probably damaging	1.00
IGL01705:Grm5	APN	7	88130046	missense	possibly damaging	0.59
IGL02184:Grm5	APN	7	88026442	missense	probably damaging	0.98
IGL02504:Grm5	APN	7	88130772	missense	probably benign
IGL02689:Grm5	APN	7	87602710	missense	probably damaging	1.00
IGL02725:Grm5	APN	7	88074665	missense	probably damaging	1.00
IGL02851:Grm5	APN	7	88074710	missense	probably damaging	0.98
IGL03106:Grm5	APN	7	88036070	missense	probably damaging	1.00
IGL03257:Grm5	APN	7	87602898	missense	possibly damaging	0.69
IGL03291:Grm5	APN	7	88130796	missense	probably damaging	1.00
BB004:Grm5	UTSW	7	88036174	missense	probably benign	0.16
BB014:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R0078:Grm5	UTSW	7	88074977	missense	probably damaging	1.00
R0314:Grm5	UTSW	7	87602955	missense	probably damaging	0.97
R0318:Grm5	UTSW	7	87602967	missense	probably damaging	0.99
R0364:Grm5	UTSW	7	88074386	missense	probably damaging	1.00
R0380:Grm5	UTSW	7	88074376	missense	possibly damaging	0.92
R0454:Grm5	UTSW	7	88130789	missense	probably damaging	1.00
R0494:Grm5	UTSW	7	88130781	missense	probably benign	0.00
R0562:Grm5	UTSW	7	87603019	missense	probably damaging	1.00
R1695:Grm5	UTSW	7	88036103	missense	possibly damaging	0.47
R2012:Grm5	UTSW	7	88074872	missense	probably damaging	1.00
R2384:Grm5	UTSW	7	87602728	missense	probably damaging	1.00
R2510:Grm5	UTSW	7	88036091	missense	probably benign	0.21
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R3861:Grm5	UTSW	7	88129994	missense	possibly damaging	0.94
R4451:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R4626:Grm5	UTSW	7	88130153	missense	probably damaging	1.00
R4728:Grm5	UTSW	7	87975288	missense	probably damaging	1.00
R4914:Grm5	UTSW	7	88130129	missense	probably benign	0.00
R5122:Grm5	UTSW	7	88074820	missense	probably damaging	1.00
R5352:Grm5	UTSW	7	88074850	missense	probably damaging	1.00
R5361:Grm5	UTSW	7	88074496	missense	probably damaging	1.00
R5684:Grm5	UTSW	7	88130645	missense	probably benign
R5715:Grm5	UTSW	7	88130256	missense	probably benign	0.05
R5759:Grm5	UTSW	7	88026600	missense	probably damaging	0.96
R5844:Grm5	UTSW	7	87804024	missense	possibly damaging	0.88
R6048:Grm5	UTSW	7	88026550	missense	probably damaging	1.00
R6145:Grm5	UTSW	7	88026601	missense	probably damaging	1.00
R6232:Grm5	UTSW	7	87602430	unclassified	probably benign
R6972:Grm5	UTSW	7	87602923	missense	probably benign	0.02
R7072:Grm5	UTSW	7	88074304	missense	probably damaging	1.00
R7258:Grm5	UTSW	7	88074706	missense	probably damaging	0.96
R7316:Grm5	UTSW	7	87975265	missense	probably benign
R7434:Grm5	UTSW	7	88130474	missense	probably benign	0.10
R7521:Grm5	UTSW	7	88074272	missense	possibly damaging	0.86
R7616:Grm5	UTSW	7	88116201	missense	probably benign
R7631:Grm5	UTSW	7	87975305	missense	probably damaging	1.00
R7655:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7656:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7739:Grm5	UTSW	7	88130058	missense	possibly damaging	0.46
R7897:Grm5	UTSW	7	88130861	missense	probably benign	0.14
R7927:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R7967:Grm5	UTSW	7	87975361	missense	probably damaging	0.99
R8260:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R8345:Grm5	UTSW	7	88074538	missense	probably damaging	1.00
R8460:Grm5	UTSW	7	87603041	missense	probably damaging	1.00
R8473:Grm5	UTSW	7	87603070	missense	probably damaging	0.97
R8531:Grm5	UTSW	7	88130516	missense	probably benign	0.05
R8671:Grm5	UTSW	7	88116290	critical splice donor site	probably null
R8805:Grm5	UTSW	7	87803968	missense	probably damaging	1.00
R9036:Grm5	UTSW	7	88036189	missense	possibly damaging	0.94
R9106:Grm5	UTSW	7	88074539	missense	probably damaging	1.00
R9136:Grm5	UTSW	7	88040046	missense	possibly damaging	0.95
R9189:Grm5	UTSW	7	88074816	missense	probably damaging	1.00
R9196:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9232:Grm5	UTSW	7	88074383	missense	probably damaging	1.00
R9234:Grm5	UTSW	7	88074232	missense	probably damaging	1.00
R9384:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9424:Grm5	UTSW	7	88116276	missense	probably benign	0.00
R9531:Grm5	UTSW	7	88130867	makesense	probably null
R9631:Grm5	UTSW	7	87975352	missense	probably damaging	0.98
R9691:Grm5	UTSW	7	88074695	missense	probably damaging	1.00
Z1176:Grm5	UTSW	7	87602715	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTCCTGCTGGCATTCTGC -3'
(R):5'- GGTGAGGAACATTTTAACCATGC -3'

Sequencing Primer
(F):5'- CATTCTGCTGTGGCCCTAGAG -3'
(R):5'- CCATGCAAAAGCTTAATATTTAGCCG -3'

Posted On

2017-02-15