Incidental Mutation 'R0557:Chchd6'
ID 45623
Institutional Source Beutler Lab
Gene Symbol Chchd6
Ensembl Gene ENSMUSG00000030086
Gene Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms 1700021B03Rik, 0710001P09Rik
MMRRC Submission 038749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R0557 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 89383146-89595652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89574587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000109179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032172] [ENSMUST00000113550]
AlphaFold Q91VN4
Predicted Effect probably damaging
Transcript: ENSMUST00000032172
AA Change: S31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032172
Gene: ENSMUSG00000030086
AA Change: S31P

DomainStartEndE-ValueType
Pfam:DUF737 16 227 1.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113550
AA Change: S31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109179
Gene: ENSMUSG00000030086
AA Change: S31P

DomainStartEndE-ValueType
Pfam:DUF737 16 179 4.8e-47 PFAM
Pfam:DUF737 173 199 9.6e-9 PFAM
Predicted Effect silent
Transcript: ENSMUST00000204654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204970
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik G A 10: 79,067,685 H266Y probably damaging Het
Abi3bp C T 16: 56,668,387 R1294C probably damaging Het
Acot3 T C 12: 84,058,856 Y366H probably damaging Het
Ago1 A G 4: 126,460,024 V254A probably benign Het
Ahnak T A 19: 9,001,944 D197E probably benign Het
Aldh1b1 A T 4: 45,802,647 T62S probably benign Het
Alox12e T C 11: 70,321,448 R135G possibly damaging Het
Amn1 T C 6: 149,171,005 Y78C possibly damaging Het
Ankmy2 G A 12: 36,187,766 S288N probably benign Het
Ano3 A T 2: 110,862,952 probably null Het
Arfgap3 T C 15: 83,303,185 D491G probably damaging Het
Arhgap15 T C 2: 44,116,617 S249P possibly damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
Cabin1 A G 10: 75,726,917 Y12H probably damaging Het
Cdkn2aip T C 8: 47,712,942 T110A probably damaging Het
Chrna3 A G 9: 55,015,865 Y220H probably damaging Het
Ctu1 A G 7: 43,677,159 D414G unknown Het
Cxxc1 C T 18: 74,218,774 R241W possibly damaging Het
Cyp3a16 A G 5: 145,469,588 I18T unknown Het
Dip2c A T 13: 9,553,459 I405F possibly damaging Het
Disp3 A T 4: 148,241,404 M1299K possibly damaging Het
Dnah9 T G 11: 66,084,666 H1519P probably damaging Het
Ehd3 C A 17: 73,829,933 Q366K probably benign Het
Exosc3 A T 4: 45,316,957 M232K probably damaging Het
Fam196a A G 7: 134,918,705 L32P probably damaging Het
Fancm T C 12: 65,118,442 probably null Het
Fgfr2 A G 7: 130,219,081 V241A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Hars2 T C 18: 36,791,077 I489T possibly damaging Het
Ice1 T C 13: 70,601,191 I1945V probably benign Het
Il33 A C 19: 29,954,636 N143T probably damaging Het
Ilvbl G A 10: 78,583,487 W313* probably null Het
Isca1 G T 13: 59,756,974 Q91K possibly damaging Het
Kcnh5 T A 12: 75,114,549 Y195F probably damaging Het
Lama4 T G 10: 39,088,397 I1355S probably benign Het
Lonrf1 T C 8: 36,230,420 D470G probably benign Het
Mak A G 13: 41,039,659 Y446H probably benign Het
Mki67 C T 7: 135,699,261 S1348N possibly damaging Het
Mpzl3 A G 9: 45,066,508 Y138C probably damaging Het
Myh8 T C 11: 67,301,798 L1501P possibly damaging Het
Naa35 A G 13: 59,627,964 E552G probably damaging Het
Ncor2 A T 5: 125,106,305 L200* probably null Het
Nrm T C 17: 35,864,632 V210A probably damaging Het
Nt5e T A 9: 88,366,466 N405K probably damaging Het
Olfr108 T A 17: 37,445,821 I100N probably damaging Het
Olfr350 T A 2: 36,850,748 I234N possibly damaging Het
Orc2 T C 1: 58,469,687 S434G probably damaging Het
Plcb4 G A 2: 135,954,349 V388I probably damaging Het
Ppm1l A G 3: 69,497,901 D177G probably benign Het
Prl8a2 A T 13: 27,352,892 R165* probably null Het
Ptbp3 G A 4: 59,517,684 R66* probably null Het
Pten A G 19: 32,817,890 T286A probably benign Het
Rac2 C T 15: 78,564,974 V113M probably damaging Het
Rai1 C T 11: 60,190,495 T1795I probably benign Het
Ros1 T G 10: 52,085,263 K1792Q possibly damaging Het
Sema6a A G 18: 47,249,500 V660A probably benign Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Slc26a5 A G 5: 21,819,764 S441P probably damaging Het
Slc27a3 A G 3: 90,386,856 L462P probably damaging Het
Spag5 T A 11: 78,314,211 S607R probably damaging Het
Spata18 A T 5: 73,651,670 N29Y probably damaging Het
Spata20 C T 11: 94,485,222 R22H probably benign Het
Spsb2 A C 6: 124,810,392 Y263S probably damaging Het
Sptbn4 C A 7: 27,408,328 E885* probably null Het
Syne2 T C 12: 75,929,301 I1175T probably benign Het
Tmem2 C T 19: 21,811,903 A567V probably benign Het
Tmem209 A C 6: 30,501,914 H253Q probably damaging Het
Trip12 A T 1: 84,724,747 D788E probably damaging Het
Usp34 T C 11: 23,403,848 S1509P probably damaging Het
Utp20 A T 10: 88,748,311 D2661E probably damaging Het
Vars C A 17: 35,004,984 P264Q possibly damaging Het
Vmn2r66 T G 7: 84,994,764 S813R probably damaging Het
Wipf2 C A 11: 98,892,089 Q114K possibly damaging Het
Wnt5b G T 6: 119,433,818 H220Q probably damaging Het
Xirp2 A G 2: 67,516,351 T2979A probably benign Het
Zfyve9 A G 4: 108,674,511 V408A probably damaging Het
Zzef1 T C 11: 72,917,730 S2744P probably damaging Het
Other mutations in Chchd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Chchd6 APN 6 89569417 splice site probably null
IGL02340:Chchd6 APN 6 89419780 missense probably damaging 0.99
IGL02490:Chchd6 APN 6 89384674 missense possibly damaging 0.90
R1170:Chchd6 UTSW 6 89384687 missense probably damaging 1.00
R1341:Chchd6 UTSW 6 89384641 missense probably benign 0.00
R1619:Chchd6 UTSW 6 89419754 missense possibly damaging 0.95
R1757:Chchd6 UTSW 6 89384644 missense probably damaging 1.00
R3886:Chchd6 UTSW 6 89467451 missense probably damaging 1.00
R4627:Chchd6 UTSW 6 89384660 missense probably damaging 1.00
R4635:Chchd6 UTSW 6 89467466 missense probably damaging 1.00
R5518:Chchd6 UTSW 6 89567585 critical splice donor site probably null
R6732:Chchd6 UTSW 6 89574454 missense probably benign 0.03
R6869:Chchd6 UTSW 6 89595496 missense probably damaging 1.00
R8673:Chchd6 UTSW 6 89569398 missense probably damaging 0.98
R9365:Chchd6 UTSW 6 89574431 missense probably benign 0.25
R9502:Chchd6 UTSW 6 89419781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCAGCCAGGCATATCTCTC -3'
(R):5'- GCCCTGAATGGAGCACTGATGATG -3'

Sequencing Primer
(F):5'- CCAACATACCTGTCAGAGGG -3'
(R):5'- ATGTGACCCCAGGGTACAG -3'
Posted On 2013-06-11