Incidental Mutation 'R5889:Fbln5'
ID456238
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101765226 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 236 (N236K)
Ref Sequence ENSEMBL: ENSMUSP00000152680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603] [ENSMUST00000222587]
Predicted Effect probably damaging
Transcript: ENSMUST00000021603
AA Change: N223K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: N223K

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221373
Predicted Effect probably damaging
Transcript: ENSMUST00000222587
AA Change: N236K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R3918:Fbln5 UTSW 12 101750791 missense probably damaging 1.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R4626:Fbln5 UTSW 12 101760827 missense probably damaging 1.00
R5004:Fbln5 UTSW 12 101760821 missense probably damaging 0.99
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAATGTCTCCAGCTAGAC -3'
(R):5'- GATCATGGTCTGATAGGTCCTCG -3'

Sequencing Primer
(F):5'- GTCTCCAGCTAGACACACAACCAG -3'
(R):5'- ACCTAGGAAGCTGGGCTCTTG -3'
Posted On2017-02-15